Enriquerubio.net El blog del Dr. Enrique Rubio

5 junio 2021

ARN, LA MOLÉCULA DE LA VIDA

Filed under: General,GENES — Enrique Rubio @ 15:14

ARN, LA MOLÉCULA DE LA VIDA

Dos de las vacunas más eficaces contra la covid se basan en un compuesto sin el que la vida en la Tierra no podría existir el ARN. Su ideación ha sido un hito en la investigación. Preparar al organismo contra el noxas tan frecuentes en nuestra patología, es un verdadero éxito.

Como siempre es la suma de múltiples investigadores que nos facilitan el camino Su aprobación puede ser el comienzo de una nueva era de tratamientos contra el cáncer, enfermedades raras y vacunas universales

Las teorías  evolutivas pasan por el ARN

 Todo lo que estas vivo se puede reproducir solo .

El ARN se puede copiar a sí mismo y evolucionar por sí solo.

Es posible que esta molécula fuese la primera entidad viva en la Tierra.

 Las dos vacunas contra el nuevo coronavirus que han mostrado una mayor eficacia hasta el momento se basan en esta molécula, en concreto en un subtipo conocido como ARN mensajero. Su trabajo es transmitir el mensaje de la vida contenido en el ADN y convertirlo en todas las proteínas que nos permiten respirar, pensar, movernos, vivir. Esta molécula es tan fundamental que se piensa que con ella pudo comenzar la vida en la Tierra hace más de 3.000 millones de años. Ahora es una de las favoritas para empezar a sacar a toda la población del planeta de la peor pandemia del siglo XXI.

Las dos vacunas más avanzadas, la de Pfizer/BioNTech y la de Moderna, han mostrado una eficacia superior al 94%.

Estas dos vacunas se pinchan en el brazo con una inyección intramuscular

Cada inyección contiene millones de nanopartículas en forma de  (pequeñas esferas

de grasa) y cada una de esas nanopartículas transporta 10 cadenas simples de ARN mensajero

El ADN es una molécula cuya función principal es almacenar toda la información genética que conforma a un ser vivo escrita con una combinación de cuatro letras: G, A, T, C. que corresponden a las bases . Guanidina, Adenina, Tiamina y citosina y se engarsan inevitablemente  

C A y G T

En el  ser humano la secuencia de ADN contiene  3.000 millones de estas letras.

El ARN es una cadena simple con tres de las mismas letras que el ADN (G, A, C) y una U en lugar de una T. 

Es mucho más inestable y frágil pero, a cambio, sirve paracasi todo.

U C G  A

El ARN copia la información genética del ADN,

ADN

Transcripción

a ARN

A

U

G

A

U

C

A

T

A

C

T

A

G

T

ARN mensajero

A

U

G

A

U

C

A

C

G

U

U

Una vez constituidas El ARN, sale del núcleo celular

La información del ADN debe permanecer intacta, inmutable, por eso está protegida en lo más interno de las células:

 Núcleo y Retículo endoplasmático

El ARN transporta la información genética del ADN fuera del núcleo y comienza a seguir sus instrucciones para producir proteínas.

Este proceso está mediado por diferentes tipos de ARN

ARNm ARN mensajero

Traduce el ADN y lleva su mensaje fuera del núcleo de la célula

ARNt ARN de transferencia

Ayuda al ensamblaje de las proteínas ARNr Ribosómico

Forma los ribosomas, las fábricas donde se construyen las proteínas

El ADN puede sobrevivir días o incluso semanas a temperatura ambiente. Incluso se conserva decenas de miles de años en algunos fósiles. El ARN, a cambio de su versatilidad, es una molécula efímera que solo está presente durante unas pocas horas en la célula mientras realiza su función concreta.

Se desintegra con mucha facilidad, sobre todo por la acción de unas proteínas inmunes ubicuas  que están tanto dentro de la célula  y en todo el organismo y su única función es destruir cualquier ARN extraño. Por eso las vacunas de ARN necesitan temperaturas de hasta 80 bajo cero: no es fácil mantener estable esta molécula a temperatura ambiente durante mucho tiempo.

Las vacunas transportan a dentro de la célula las instrucciones de ARN externo para que las células produzcan la proteína de la espícula del virus, que por sí sola son inofensiva

Coronavirus

El mensaje genético del virus esta escrito con 29.903 letras, de las cuales 3.831 conforman la proteína de la espícula que es esencial para que el coronavirus pueda infectar AUGUUUGUUUUCUU…

Esas nanopartículas inyectadas   penetran en diferentes células del cuerpo y  sueltan las cadenas de ARN

El ARN es localizado por los ribosomas sin pasar por el núcleo de la célula

Citoplasma

Los ribosomas son los encargados de traducir ese ARN para crear las proteínas de la espícula del virus

Cómo se traduce el ARN en proteínas

Una vez que el ARN mensajero lee la información genética del ADN, se sirve de los ribosomas y del ARN de transferencia para crear proteínas.

Ribosoma

ARN mensajero

Dentro del ribosoma de la célula, cada tres letras se unen a un ARN de transferencia (ARNt), una molécula que lleva tres letras complementarias y un aminoácido específico

ARNt

Aminoácido

Estos aminoácidos se van uniendo como perlas en un collar para dar lugar a las proteínas que forman el virus.

Proteína de la espícula del virus

Cualquier vacuna es una simulación de una infección. Su objetivo es provocar una respuesta del sistema inmune ante un patógeno sin dejar que este cause enfermedad. Las vacunas de Moderna y BioNTech usan una técnica diferente a las convencionales, basadas en virus completos atenuados —sarampión—, desactivados —gripe— o en fragmentos de este. Las vacunas de ARN mensajero usan las células del cuerpo como biorreactores para que produzcan copias de la proteína S del coronavirus y que estas sean localizadas por el sistema inmune.

Aquí está una de las diferencias más importantes entre las vacunas de Moderna, la de BioNTech y las de otras empresas y centros de investigación que desarrollan inyecciones similares.

Una vez la vacuna entra en el músculo del brazo, las nanopartículas pueden migrar por el sistema linfático hasta llegar a los ganglios y el bazo

Nódulos linfáticos

Una vez allí las nanopartículas entran directamente en las células dendríticas, fagocitos del sistema inmune innato

Estas células producen la proteína S y se la muestran a otros dos tipos de glóbulos blancos, lo que da comienzo a la respuesta inmune adaptativa, la más sofisticada y efectiva contra el virus

Linfocitos CD8+ T

Linfocitos CD4+ T

Activan los linfocitos B

Son capaces de identificar y aniquilar a una célula infectada de coronavirus que generan anticuerpos, proteínas capaces de unirse al virus e impedir que infecte. Esta línea también incluye células de memoria capaces de recordar a los virus y reactivar la alerta inmunitaria meses, incluso años después.

 Ugur Sahin, fundador de BioNTech, fue uno de los primeros en el mundo en estudiar en humanos una vacuna de ARN. Lo hizo en 2017 para intentar tratar el cáncer. La idea era desarrollar una vacuna específica para cada paciente como si su tumor fuese un virus, destaca la importancia de que la vacuna se dirija específicamente a células del sistema inmune, lo que les permite dar una dosis de vacuna unas tres veces menor que Moderna para obtener los mismos resultados. “Una dosis más baja supone que la vacuna es más segura y permite fabricar más dosis .

LA VACUNA CONTRA EL CANCER

Tumor del paciente

Primero se lee todo el ADN del tumor e identifica unos pocos rasgos únicos: 

Las proteínas de su superficie conocidas como antígenos

Después se escribe y produce un ARN mensajero capaz de fabricar esas proteínas

Cuando ese ARN entra en la célula, comienza el proceso de producción de antígenos del tumor Y activa las defensas del cuerpo ante el cáncer

Respuesta inmune

Moderna también surgió como empresa para desarrollar este tipo de vacunas personalizadas y hay una tercera compañía muy adelantada en este campo, la alemana Curevac. Todas, además, desarrollan inmunizaciones contra otros patógenos como la rabia, el zika o el citomegalovirus, un patógeno que puede producir sordera, retraso mental y otros problemas graves en una fracción de los bebés que nacen infectados.

“Las vacunas de ARN pueden revolucionar la medicina”, asegura Norbert Pardi, investigador de la Universidad de Pensilvania (EE UU).

. Moderna tardó 42 días en tener un ARN mensajero candidato a vacuna después de que China publicase la secuencia genética completa del SARS-CoV-2. En comparación, se tarda una media de 10 años en desarrollar una vacuna convencional.

Tiempo de fabricación de las vacunas

La vacuna más rápida, contra el ébola, tardó cinco años en ser descubierta.

 Y una serie de vacunas también demoraron su construccion

Rotavirus 20 años

Sarampión 22 años

Malaria 9 años

Virus del papiloma humano 31 años

Ébola 15 años

Para el VIH y el zika aún no se ha encontrado vacuna Zika

La secuencia de los ARN mensajeros se escribe en un ordenador y después se produce de forma química, sin necesidad de usar células, lo que puede resultar más barato si finalmente estas vacunas tienen éxito y la tecnología para producirlas llega a escalarse.

El ARN puede resultar más seguro que otras vacunas basadas en ADN, proteínas o virus completos. Esta molécula por sí sola no es infecciosa y es incapaz de integrarse en nuestro ADN, lo que podría causar mutaciones peligrosas que se transmitirían de generación en generación. En la actualidad hay unos 50 ensayos clínicos en marcha para probar la eficacia de este tipo de vacunas contra tumores de todo tipo, incluidos los casos más graves en los que hay metástasis. También hay casi una veintena de vacunas en ensayos contra infecciones virales como la gripe, el VIH, el zika y otras.

La gran pregunta sobre estas vacunas es cuánto dura la inmunidad que generan. “Con que las vacunas de ARN mensajero contra covid protejan durante dos o tres años sería satisfactorio porque nos permitiría controlar la epidemia”, opina Felipe García, investigador del Hospital Clínico de Barcelona que participa en un consorcio español de desarrollo de una vacuna de ARN mensajero contra el nuevo coronavirus. Nadie sabe la duración de la inmunidad que generan estas vacunas porque sencillamente son demasiado nuevas. Si finalmente son aprobadas habrá que esperar años para conocer su efectividad en el tiempo, por eso los ensayos clínicos van a continuar por lo menos hasta 2022.

Por el momento no hay ninguna vacuna de ARN mensajero aprobada contra ningún tipo de virus o enfermedad. Sus resultados contra el cáncer han sido mucho menos claros que con la covid. Las vacunas de ARN contra el cáncer parecen seguras y consiguen frenar el avance de los tumores, pero solo en una fracción reducida de pacientes. Los pacientes que sí responden a la vacuna pueden estar sin cáncer hasta tres años y medio.

Hay dos descubrimientos científicos recientes sin los que no serían posibles estas vacunas. El primero data de finales de la década pasada y lo hicieron Katalin Karikó, bioquímica de origen húngaro que actualmente trabaja para BioNTech, y Drew Weissmann, de la Universidad de Pensilvania (EE UU). Ambos desarrollaron un ARN mensajero modificado que incluye un pequeño cambio químico en su fórmula que lo hace mucho más digerible para el sistema inmune, lo que facilita que la molécula llegue intacta a donde tiene que llegar. Aún así, inyectar este ARN solo no conseguía grandes efectos. A partir de 2015, Karikó, Weissmann y Pardi desarrollaron vacunas que protegían la secuencia de ARN dentro de una nanopartícula hecha de lípidos (grasa), lo que permitía llevar la carga de forma mucho más eficiente a las células. La formulación de esa burbuja y la secuencia exacta del ARN modificado son fundamentales para el éxito de estas vacunas. Cada empresa tiene su propia fórmula y en ella están las claves de su eficacia.

La gran barrera para estas vacunas es la necesidad de preservarlas a temperaturas de hasta 80 grados bajo cero. Llevar millones de vacunas así a países con una cadena de frío deficiente o inexistente es un reto al que nunca antes se ha enfrentado la humanidad.

La tecnología para que estas inyecciones se mantengan a temperaturas factibles ya existe. Moderna ha anunciado que su vacuna aguanta hasta un mes a temperaturas típicas de una nevera convencional y Sahin explica que su equipo está trabajando en una nueva formulación que se mantenga estable a temperatura ambiente.

“Nuestra vacuna de ARN mensajero contra la covid aguanta a cinco grados por lo menos tres meses”, explica Mariola Fotin-Mleczek, directora técnica de Curevac, una empresa alemana surgida en 2000 de la Universidad de Tubinga. Su vacuna ha obtenido resultados prometedores en las pruebas en humanos y se dispone a empezar la última fase de pruebas para demostrar su eficacia. La Unión Europea ha acordado la compra de 225 millones de dosis de su vacuna si finalmente funciona, que se sumarían a las ya acordadas con BioNTech, Astra Zeneca, Sanofi, Janssen y posiblemente Moderna. Si estas vacunas finalmente se aprueban y resultan efectivas será “el comienzo de una nueva era”, explica Mleczek, experta en inmunología. “La formulación de estas vacunas es muy fácil y rápida y se pueden aplicar a casi cualquier patógeno, de forma que podríamos desarrollar vacunas multivalentes para la gripe, el covid y otros virus, todo en uno”, explica.

Hay otro posible factor limitante: el precio. Las vacunas de Moderna (23 euros) y BioNTech (15) son cuando menos cinco veces más caras que la desarrollada por la Universidad de Oxford y Astrazeneca, por ejemplo. Como referencia, todas las vacunas que se ponen en África cada año tienen un precio conjunto por persona de unos cuatro dólares. “Las vacunas de ARN nos sacarán de esta pandemia, pero solo junto a las otras, incluidas las más convencionales. En lo que las de ARN son imbatibles es en la rapidez de desarrollo, lo que es muy importante en pandemias”, señala Felipe García, del Clínico.

La fabricación en masa de estas vacunas es posible. “Las técnicas que actualmente usamos para producir estas vacunas en el ámbito académico es fácilmente escalable, así que es factible poder producir dosis para 10.000 millones de personas en uno o dos años”, explica Cristina Fornaguera, investigadora del Instituto Químico de Sarriá, en Barcelona. En 2016 su equipo colaboró con Moderna en la formulación de vacunas de ARN. Junto a Salvador Borrós ha diseñado vacunas liofilizadas —deshidratadas— de ARN que permiten conservarlas a cuatro grados.

España no tiene actualmente ninguna empresa que pueda fabricar vacunas de ARN mensajero, explica Ion Arocena, director de la Asociación Española de Bioempresas (Asebio). “Estos candidatos a vacuna contra la covid se han desarrollado en un tiempo récord y con un esfuerzo que no tiene precedentes en la historia. Si salen adelante se abrirá la puerta a toda una nueva categoría de fármacos. En este punto hay que recordar que empresas como Curevac han recibido 300 millones de euros del Gobierno alemán para el desarrollo de su vacuna. En España, el fondo de covid del CDTI ha financiado a tres empresas que desarrollan candidatos de vacuna por unos 500.000 euros. Viendo la situación uno se pregunta si el desarrollo de estas vacunas hubiera podido suceder en España”, comenta.

El futuro: edición genética de ARN

Más allá de los fármacos, el ARN puede darle a la humanidad un mayor control sobre su destino como especie. En 2011 se descubrió cómo reescribir el genoma de cualquier ser vivo gracias a la edición genética CRISPR. Esta tecnología revolucionaria funciona solo con el ADN y esto supone que hace cambios permanentes en el libro de la vida. Por eso ahora un número creciente de laboratorios y empresas buscan una forma de editar el ARN, pues no implica estos riesgos. Aunque las técnicas para reescribir el ARN están en pañales y solo pueden hacer cambios puntuales de una letra genética por otra, sus aplicaciones son interesantísimas: un solo cambio de una letra de ARN podría evitar enfermedades raras como la distrofia muscular. Más allá, desarrollar unas tijeras que corten el ARN podría permitir crear un tratamiento capaz de aniquilar al 80% de los coronavirus conocidos y potencialmente a muchos otros virus cuyo genoma está hecho de esta molécula. De hecho esta es una gran diferencia entre las cosas vivas y las que no lo están: todos los seres vivos del planeta se basan en el ADN para vivir y reproducirse, pero hay muchos virus, incluido el SARS-CoV-2, que están hechos solo de ARN. Por eso necesitan entrar en otros seres vivos y secuestrar su maquinaria biológica para multiplicarse.

Referencias

NUÑO DOMÍNGUEZ y |ARTUR GALOCHA

Mariola Fotin-Mleczek, directora técnica de Curevac

29 NOV 2020

14 mayo 2021

GUARDIANES DEL GENOMA

Filed under: GENES,TUMORES — Enrique Rubio @ 20:20

GUARDIANES DEL GENOMA P53 y SWI/SNF

Es casi natural pensar que en la multiplicación del genoma, se formen  malformaciones genéticas y también es lógico que el organismo tenga guardianes , que vigilen y reparen las mutaciones que van apareciendo.

El fallo de un complejo sistema que facilita la replicación y transcripción del material genético genera híbridos tóxicos de ADN y ARN

El cáncer consiste en el desarrollo de células anormales que se dividen, crecen y se diseminan sin control. La división celular es un mecanismo biológico natural, pero cualquier fallo en el proceso de replicación y transcripción del material genético puede hacer que la célula, en vez de morir de forma natural, comience a dividirse sin límite formando las masas, denominadas tumores o neoplasias, que terminan por destruir y sustituir tejidos normales.

Andrés Aguilera, en el laboratorio.

Una investigación de la Universidad de Sevilla (US) en el Centro Andaluz de Biología Molecular y Medicina Regenerativa (CABIMER), publicada en Nature Genetics, ha identificado el mecanismo de una de las mutaciones (cambios en la secuencia natural del ADN) más frecuentes en los tumores, un hallazgo fundamental para entender los procesos cancerígenos.

En el ADN, las bases deben situarse exactamente igual en los nucleótidos que dan lugar a una nueva celula.  

Durante la multiplicación, existe un complejo regulador de la replicación, que impiden el fallo del sistema que facilita la replicación y transcripción del material genético, donde frecuentemente y por intercurrencias, se generan híbridos tóxicos de ADN y ARN.

Existen unos guardianes de esta función, algunos de los cuales, se les conoce hace tiempo, son los supresores tumorales, como el P53, y se encargan de producir proteínas que vigilan y controlan los procesos de transcripción y replicación. Un cambio (mutación) en estos genes puede hacer que no cumplan su función y comience la división celular sin control.

El p53 es una proteína supresora de tumores.1​ En la especie humana, el gen p53 o TP53, también llamado el «guardián del genoma», se encuentra en el brazo corto del cromosoma 17 (17p13) y codifica un factor de transcripción nuclear de 43.7 KDa. Su nombre hace referencia a su masa molecular aparente: corre como una proteína de 53 KDa en un SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis, o, en castellano, electroforesis en gel de poliacrilamida con sodio dodecil sulfato ) . Esta diferencia se debe a la gran cantidad de residuos de prolina que contiene p53, lo que la hace migrar más lentamente en un SDS-PAGE, haciendo que parezca más pesada de lo que realmente es.

Resulta esencial para inducir la respuesta de la célula ante el daño del ADN, deteniendo el ciclo celular en caso de mutación. El gen p53 es un gen supresor tumoral que desempeña un papel importante en apoptosis y control del ciclo celular. Un p53 defectuoso podría permitir que las células anormales proliferen dando por resultado cáncer (alrededor de un 50 % de todos los tumores humanos contienen mutaciones en p53).2

p53 pertenece a una familia de factores de transcripción, a la cual pertenecen también p63 y p73. Estas tres proteínas colaboran en una compleja red de interacciones que aún no se conoce en su totalidad. Sin embargo, p53 es ubicuo (se expresa en todos los tejidos), mientras que p63 y p73 presentan especificidad tisular. Además, parece que todos ellos presentan isoformas, algunas de las cuales funcionan como activadoras, mientras que otras funcionan como negativas dominantes.

Las alteraciones en el P53, conocido como el “guardián del genoma”, son las más habituales detectadas en los tumores. Pero existen otros protectores del geoma, mas recientemente conocidos. .

Este nuevo mecanismo, cuyo papel no estaba claro hasta la investigación recién publicada, comienza en un complejo de proteínas, conocido como cromatina SWI/SNF (SwItch/Sucrose Non Fermentable), que tiene como función remodelar y acomodar la cubierta del ADN (histonas) para permitir la expresión de los genes o la replicación del genoma. En ese proceso de actuar sobre el envoltorio del ADN juega un papel fundamental el Brahma-related gene-1 (BRG1), un componente de la cromatina y modulador crítico para regular la transcripción, reparación y recombinación genética en los procesos celulares.

La familia SWI/SNF (de sus siglas en inglés «SWItch/Sucrose Non Fermentable»)12​ es un complejo remodelador del nucleosoma de levaduras compuesto de diversas proteínas, producto de los genes swi y snf, así como de otros polipéptidos.3​ Además, este complejo posee actividad ATPasa estimulada por ADN, pudiendo desestabilizar las interacciones histonasADN de un modo dependiente de ATP, aunque la naturaleza exacta de este cambio estructural aún no se conoce.

Hasta ahora se han descrito una  familia SWI/SNF

LevaduraHumanoFunción
SWI1ARID1AARID1Bcontiene motivos de unión LXXLL de receptor nuclear
SWI2/SNF2SMARCA4remodelación de la cromatina dependiente de ATP
SWI3SMARCC1SMARCC2secuencia similar, función desconocida
SWP73SMARCD1SMARCD2SMARCD3secuencia similar, función desconocida
SWP61ACTL6AACTL6Bproteína semejante a actina

El complejo SWI/SNF (en levaduras) es capaz de alterar la posición de los nucleosomas a lo largo del ADN.5

Se han observado dos mecanismos para la remodelación de los nucleosomas mediada por SWI/SNF.6

  • El primer modelo propone que una difusión unidireccional de un defecto en el enrollamiento del ADN alrededor del nucleosoma resulta en una extensión del ADN sobre la superficie del octámero que permite la entrada del ADN al sitio de unión con el nucleosoma.
  • El segundo modelo es denominado mecanismo de «protuberancia» o de «recaptura de bucle» e implica la disociación del ADN en el límite del nucleosoma, con una reasociación del ADN dentro del nucleosoma, formando así una protuberancia de ADN sobre la superficie del octámero. El bucle de ADN se propagaría entonces a lo largo de toda la superficie del octámero de histonas como si fuera una ola. De este modo, el ADN se posicionaría de nuevo sin cambios en el número total de contactos ADN-histona.7​ Un reciente estudio ha proporcionado nuevas evidencias en contra del mecanismo de difusión del giro, apoyando así al mecanismo de «recaptura de bucle», el cual ha sido esquematizado en la figura que se muestra abajo.8

.

Sin estos elementos, los procesos de replicación y transcripción chocan y se genera la inestabilidad que caracteriza a los tumores. “El remodelador SWI/SNF es el vigilante que regula el tráfico,  cualquier alteración en el complejo SWI/SNF, vigilante de ese tráfico, genera la inestabilidad genética, que da lugar a la  mayoría de tumores.

“El complejo SWI/SNF es necesario para que las células puedan resolver los conflictos que se dan en los cromosomas cuando las maquinarias de transcripción y replicación colisionan en un mismo sitio obstaculizándose mutuamente”,.

El resultado del fallo causado por las mutaciones en el complejo SWI/SNF es la generación y acumulación de moléculas híbridas de ADN y ARN que resultan tóxicas y que los investigadores creen que están presentes de forma frecuente en los tumores. Según el estudio, “el impacto de las alteraciones de SWI/SNF podría explicar la prevalencia de sus mutaciones en las neoplasias malignas humanas y por qué los factores de este complejo están mutados más ampliamente que cualquier otro supresor tumoral u oncogén”.

 “Una mutación inicial se produce accidentalmente y, si esta afecta el ADN, en este caso SWI/SNF, o la división celular, la célula pierde el control sobre la integridad del genoma y comienza la cascada de alteraciones genéticas que pueden desembocar en cáncer. Identificar esta mutación en sus primeras fases permitiría establecer un biomarcador en estados muy iniciales del cáncer y, en un futuro, ser usadas en prevención y terapias personalizadas”.

Andrés Aguilera, en el laboratorio.U S

Hao Zhu, investigador del Children’s Medical Center Research Institute del hospital UT Southwestern (Texas), y autor de otro estudio sobre la cromatina publicado en Nature cancer,coincide en que los complejos de cromatina SWI/SNF desempeñan un papel crucial en el desarrollo de tejidos normales y, cuando se alteran, pueden conducir al desarrollo del cáncer: “Estos complejos son comúnmente alterados por mutaciones en los genes que los codifican, pero se conoce poco cómo esto conduce al tumor. Si bien está muy claro que los componentes SWI/SNF son defectuosos en casi todos los tipos de cáncer, todavía hay confusión sobre cómo las mutaciones en los componentes conducen a enfermedades”.

El ciclo de transcripción genética, “este proceso está muy coordinado con el fin de asegurar que los genes correctos se expresen en los momentos y niveles adecuados para que la célula funcione correctamente”.

Los reguladores de la multiplicación celular son imprescindible, para la organización correcta del ADN, pero seguro que este mecanismo de tumorizacion del genoma no es el único, pero si imprescindible

Referencias

 Neigeborn L, Carlson M (1984). «Genes affecting the regulation of SUC2 gene expression by glucose repression in Saccharomyces cerevisiae»Genetics 108 (4): 845-58. PMID 6392017.

 Stern M, Jensen R, Herskowitz I (1984). «Five SWI genes are required for expression of the HO gene in yeast». J. Mol. Biol. 178 (4): 853-68. PMID 6436497doi:10.1016/0022-2836(84)90315-2.

 Pazin MJ, Kadonaga JT (1997). «SWI2/SNF2 and related proteins: ATP-driven motors that disrupt protein-DNA interactions?». Cell 88 (6): 737-40. PMID 9118215doi:10.1016/S0092-8674(00)81918-2.

 Collingwood TN, Urnov FD, Wolffe AP (1999). «Nuclear receptors: coactivators, corepressors and chromatin remodeling in the control of transcription». J. Mol. Endocrinol.23 (3): 255-75. PMID 10601972doi:10.1677/jme.0.0230255.

 Whitehouse I, Flaus A, Cairns BR, White MF, Workman JL, Owen-Hughes T (agosto de 1999). «Nucleosome mobilization catalysed by the yeast SWI/SNF complex». Nature 400(6746): 784-7. PMID 10466730doi:10.1038/23506.

 van Holde K, Yager T (2003). «Models for chromatin remodeling: a critical comparison». Biochem. Cell Biol. 81 (3): 169-72. PMID 12897850doi:10.1139/o03-038.

 Flaus A, Owen-Hughes T (2003). «Mechanisms for nucleosome mobilization». Biopolymers 68 (4): 563-78. PMID 12666181doi:10.1002/bip.10323.

 Zofall M, Persinger J, Kassabov SR, Bartholomew B (2006). «Chromatin remodeling by ISW2 and SWI/SNF requires DNA translocation inside the nucleosome». Nat. Struct. Mol. Biol. 13 (4): 339-46. PMID 16518397doi:10.1038/nsmb1071

Andrés Aguilera, catedrático de genética de la Universidad de Sevilla.U S 14 MAY 2021 – 11:07 CEST

24 abril 2021

REPLICACION DEL ADN

Filed under: General,GENES — Enrique Rubio @ 18:29

La replicación del DNA aspectos generales

Entender el cambio de cadenas de ADN a ARN, es de tal dificultad, que cuesta un esfuerzo enorme comprender como los investigadores llegan a estas maravillosas conclusiones

La replicación del DNA es parcial con cada cadena parental actuando como molde para la síntesis de una nueva cadena complementaria.

En primer lugar el DNA se desenrolla y se rompen los puentes de hidrógeno entre las dos cadenas este proceso es ayudado por la enzimas a las proteínas en las antes a cadena simple SSB y evitan que las cadenas se vuelvan a unir, esto crea una burbuja de replicación las. LAS burbujas de replicación se forman en múltiples lugares a lo largo de la molécula de DNA aumentando considerablemente la velocidad de la replicación.

mIRAB más de cerca a un extremo de la burbuja de replicación

Esto es una horquilla de replicación una vez que las cadenas han sido desarrolladas y separadas la DNA polimerasa puede comenzar a construir

una nueva cadena la hebra conductora es la nueva cadena que crece de modo continuo hacia la horquilla de replicación la DNA polimerasa construye la nueva cadena en dirección 5 prima 3 sin embargo la DNA polimerasa no puede iniciar una nueva cadena, solo puede prolongar una cadena preexistente las  primas a colocar los primeros

nucleótidos de la nueva cadena el segmento resultante deRNA cebador proporciona un extremo 3 prima libre al que enlazarse la DNA polimerasa puede ahora ir colocando los nucleótidos complementarios a medida que se desplazan a lo largo de la cadena molde obsérvese que la DNA  polimerasa lee la cadena molde en dirección 3 prima la hélice continúa desarrollándose y abriéndose permitiendo a la hebra conductora crecer de modo continuo en la dirección de la horquilla de replicación más tarde un tipo diferente de DNA polimerasa reemplaza el cebador de rn por tn como se forma la nueva cadena de DNA veamos el proceso con más detalle echemos un vistazo más de cerca a la construcción de la nueva cadena de DNA la DNA polimerasa 3 trae el siguiente nucleótido trifosfato  Enlos tres grupos fosfato la energía es liberada cuando se rompe este enlace esta energía se usa para polinizar la nueva cadena de DNA la polimerización es el proceso por el que se forman las nuevas cadenas

El proceso de acción otra vez la energía se libera el fosfato se une al grupo h libre los puentes de hidrógeno se forman entre los nucleótidos así es cómo se polimeriza las nuevas cadenas de ADN .

La hebra rezagada se sintetiza en dirección opuesta a la del avance de la horquilla de replicación la hebra rezagada es la nueva cadena que crece de modo discontinuo alejándose de la horquilla de replicación en primer lugar laRNA primas a añade un fragmento deRNA cebador entonces la DNA polimerasa comienza a sintetizar la nueva cadena de DNA antes de que pueda continuar la síntesis de la hebra rezagada la hélice debe continuar desarrollándose así la hebra rezagada se sintetiza de manera discontinua una vez más la RNA primas a la nueva cadena los tramos discontinuos se denominan fragmentos de Okazaki al igual que en la hebra conductora una DNA polimerasa diferente cambie RNA x DNA esta ADN a polimerasa cambia el RNA x de n y entonces una ligazas sellan la unión de los fragmentos de TN la replicación continúa de este modo a lo largo de la hebra rezagada sintetizando fragmentos a medida que la hélice se desenrolla la nueva cadena es una copia exacta de la otra cadena parental fijémonos ahora en el conjunto de la burbuja de replicación las hebras conductora y rezagada comienzan a replicarse trabajando en direcciones opuestas mientras tanto otra hebra conductora se está replicando sobre la cadena opuesta de la burbuja hay una segunda hebra rezagada en el extremo opuesto y ahora una segunda DNA polimerasa añade desoxirribonucleico cambiando los fragmentos deRNA x DNA finalmente una liga se sella la unión de los fragmentos de pene ahora veamos la burbuja de replicación completa en acción pero este proceso continúa en ambas direcciones hasta que la molécula completa de DNA ha sido replicada hay múltiples burbujas de replicación a lo largo de la molécula de DNA las burbujas continúan creciendo hasta que llegan a unirse ahora tenemos dos moléculas completas de DNA

La bibliografía esta extraída de repetidos trabajos de Internet

22 abril 2021

EL ADN, LOS NUCLEOTIDOS

Filed under: GENES — Enrique Rubio @ 20:35

EL ADN, LOS NUCLEOTIDOS

El ADN ácido desoxirribonucleico es el material genético que se encuentra en  el  interior del núcleo de nuestras  celulas

La imagen tiene un atributo ALT vacío; su nombre de archivo es descarga-18.jpg

Flipy  estudio en células sanguíneas, un material viscoso con alto contenido en fosfato y si bien no fue capaz de describir cómo era esta sustancia si pudo descartar que está fueran proteínas carbohidratos o lípidos por lo que se pudo afirmar que era un nuevo tipo de material al que posteriormente se les llamo “ácidos nucleicos”

Flipy hizo dos experimentos con ratas a las que inyecto, cepas de una misma bacteria

La primera de ellas al inyectar a un animal,  no le pasaba nada.

A la segunda le inyecto unas bacterias patógenas. Y los animales morían todos.

Descubrió que si la segunda cepa era destruida mediante calor perdía su capacidad de enfermar al animal por lo tanto era seguro inyectar al animal no le pasaba  nada.Pero si inyectaba a los animales, las bacterias muertas por el calor, mezcladas con cepas de gérmenes patógenos, los animales morían.

Existía algo en la bacteria, capaz de matar la crelula. Le llamó “ principio de transformancion”,  

Ya sabían que que existían algunos tipos de virus llamados Fagos capaces de transferir la información a las bacterias a las que podría infectar y se preguntan en qué lugar del Fago se encontraba esta información, para descubrirlo tomaron dos fagos distintos y los marcaron mediante radioactividad.

Al primer grupo le inyectaron en el interior del núcleo en los ácidos nucleicos y al segundo en el resto de su estructura.

Las proteínas después le permitieron a los Fagos infectar a distintas bacterias y para saber que parte del Fago era la que había entrado en las bacterias y vieron en donde se encontraba la radioactividad.

En el caso del Fago que tenía el material nuclear marcado la radioactividad quedó al interior de la bacteria, sin embargo en el caso del fago que se le había puesto calor y le habían marcado las proteínas, la radioactividad quedó fuera esto permitió saber que el material genético ADN se encontraba al interior del núcleo de los organismos y correspondía a la información que éstos traspasaban.

La imagen tiene un atributo ALT vacío; su nombre de archivo es images-24.jpg

Científicos entre los cuales destacan vinos Pauline Maurice Wilkins Ervin y sobre todo Rosalind Franklin obtuvieron la primera imagen del ADN mediante una técnica llamada CRISTALOGRAFÍA DE RAYOS X y dio paso a que otros dos científicos ; Watson y Crick fueran capaces de construir el primer modelo tridimensional del ADN explicando así su estructura  y este  modelo fue el primero en dar explicación a toda la  evidencia que existía en ese momento incluyendo las imágenes de cristalografía obtenidas

El modelo de  ADN está compuesto de nucleótidos, estos estan compuesto por tres partes un grupo Fosfato, un Azúcar de 5 carbonos llamado Ribosa y una parte variable que corresponde a una base en inclusión de la cual existen cuatro tipos TIMINA ADENINA CITOSINA Y GUANINA las cuales se identifican con la primera letra de su nombre el modelo

T.A.C.G.  además los nucleótidos se encuentran unidos uno tras el otro  por puentes de hidrógeno.

Estas hebras tienen un sentido anti paralelo es decir que si una va en direcciones de arriba hacia abajo la otra irá en dirección de abajo hacia arriba de esta forma se conforma una especie de escalera típica que luego se enrollará para formar una doble hélice y este enrollamiento dejará espacios que permitirán ver las hélices y las bases nitrogenadas abriendo un espacio grande llamado mayor y un espacio pequeño llamado surco menor

La estructura del ADN la forman bases nitrogenadas que se unen mediante cuerpos de hidrógeno en el modelo de Watson y Crick

La ADENINA SOLO PODRÁ UNIRSE CON LA TIMINA formando siempre dos fuentes de hidrógenos por su parte LA GUANINA SÓLO SE UNIRÁ CON LA TIMINA,  formando tres cuentas de hidrógeno es por eso que los segmentos de ADN que tienen un mayor contenido de Adenina y Citosina serán más difíciles de separar por lo tanto serán segmentos más estables, por el contrario cuando el contenido de Adenina-Timina es alto se requerirá menos energía para separarlo ya que habrán menos enlaces que romper, este es el caso de aquellos lugares en el ADN que son ampliamente utilizados y por lo tanto deben estarse separando y viendo muy a menudo del ADN que conocemos se presenta en la gran mayoría de los casos de acuerdo al modelo moldeado por Watson y Crick. Existen también otros modelos de ADN que se han encontrado en algunos organismos un modelo que conocemos clásico recibe el nombre de ADN Y POBRE sin embargo en algunas condiciones se ha logrado un modelo de doble hélice más achatada y ancha que deja en el centro un surco .

El ADN tipo, en algunos otros niños se ha encontrado un modelo más alargado y de diámetro mucho menor al que se llama ADN TIPO SET

21 abril 2021

GENOMA OSCURO’: OTRA TEORÍA DE LA EVOLUCIÓN

Filed under: GENES — Enrique Rubio @ 20:24

.

‘GENOMA OSCURO’: OTRA TEORÍA DE LA EVOLUCIÓN

Una serie de mutaciones genéticas en ratoncillos del desierto abre una nueva forma de ver como funciona su supervivencia

Las secuencias de ADN tienen muchas partes indescifrables. Son las que se llamaron genoma ‘oscuro’ o ‘basura’ y que llegan a suponer hasta el 95% del total.

Desde 2010, a través de una tecnología más sofisticada, se han ido descubriendo partes muy relevantes de estas zonas veladas. El investigador Adam Hargreaves narra en ‘The Conversation’ su particular aventura con lo que él llama ‘genoma oscuro’ (que no es exactamente lo mismo a lo que otros grupos de científicos se refieren) tratando de analizar los genes responsables de la producción de insulina en esos pequeños ratoncillos del desierto conocidos como jerbos.

Estos estudios aclaran muchas de las preguntas que se hacían sobre el reino animal desde hace años. Pero, a veces, se topan con “un misterio”. Algunos genomas animales parece que han “perdido” genes que deberían estar allí para permitir a esas especies estar vivas. Pero existen, están allí, en alguna parte, y esa evidencia podría cambiar la manera en la que se entiende la evolución.

Cuando el grupo de científicos capitaneados por Heargreaves empezó a buscar un gen llamado Pdx1, el que controla la secreción de insulina, se dieron cuenta de que estaba perdido, al igual que otros 87 que lo rodean en la secuencia habitual. Sin el Pdx1 el animal no podría sobrevivir, así que tenía que estar en alguna parte.

La primera pista que hallaron para encontrarlo fue que en los JERBOS estaban las sustancias químicas con las instrucciones que dan los genes “perdidos”. Eso solo era posible si, efectivamente, estaban en el genoma. Así que en realidad no estaban realmente desaparecidos, sino “escondidos.

El genoma,  es todavía un misterio pese a que hace ya casi dos décadas que se publicó la primera secuencia prácticamente completa de nuestro ADN, los expertos no se ponen de acuerdo aún sobre cuántos genes tenemos con exactitud. Y la cosa acaba de complicarse un poco más: científicos de la universidad de Yale han confirmado en ratones la existencia de al menos un gen con su proteína asociada en lo que tiempo atrás se consideraba mero ADN basura, un lugar fuera del mapa.

Desde que en 2012 se publicaron los datos completos del proyecto Encode, encargado de secuenciar la mayoría del ADN oscuro, se pensó que los nuevos datos contribuirían a mejorar los tratamientos oncológicos. La forma de hacerlo sería analizando el genoma de cada paciente y aplicando uno u otro fármaco dependiendo de su perfil.

En la evolución del genoma de un animal, se observan a menudo, que algunos genomas animales no tienen ciertos genes que otras especies similares tienen y estos genes son necesarios para que este animal esté vivo, razón por la cual han decidido llamarle «ADN oscuro» porque de alguna forma hace recordar a la materia oscura

La  Next Generation Sequencing

Compara la informacion secuenciada con los diferentes genomas y bases de datos con el fin de encontrar la informacion sensible .

Localizamos, analizamos y filtramos dichos datos.

Creamos un informe con toda la informacion necesaria para el cliente. Dicho informe se consensua siempre con el cliente para que se adapte con sus necesidades.

Análisis de variantes

Es un tipo de analisis de datos de secuenciacion cuyo objetivo es ver las variaciones que presenta la secuencia genomica de la muestra respecto a la del genoma considerado de referencia. 

Mediante la tecnología de secuenciación de ADN. los científicos están aclarando algunas preguntas que los humanos se han hecho sobre los animales durante siglos, mapeando los genomas de animales ahora tenemos una mejor idea de cómo es que la jirafa tiene el cuello con ese tamaño y por qué las serpientes son tan largas.

La secuenciación del genoma nos permite comparar y contrastar el ADN de diferentes animales y descubrir cómo evolucionaron de diferentes maneras y cómo es que algunos evolucionaron de manera tan particular.

Pero en algunos casos los científicos se encuentran con un misterio.

Sabemos que la materia oscura está ahí, simplemente no podemos detectarla.

El descubrimiento del ADN oscuro es algo reciente y aún se está investigando para determinar qué tan extendido está y si las especies que lo poseen pueden tener algunos beneficios con respecto a las otras.

Veamos el ejemplo del: «Jird gordo» este animal vive en madrigueras, come alrededor del 80 por ciento de su masa corporal en hojas cada día y no bebe agua pero lo realmente raro es que parte de su ADN parece estar perdido.

Al estudiar más su genoma se ha descubierto de una parte de él en particular tenía muchas más mutaciones que las que se encuentran en otros genomas de roedores y han mutado a tal grado que son difíciles de detectar usando métodos estándar.

Se sabe por experiencia que una mutación excesiva impide el funcionamiento de un gen, pero eso no parece suceder con este roedor que sin importar esta excesiva cantidad de mutaciones sigue funcionando normalmente

En la década de 1960 se descubrió que cuando estos roedores eran alimentados con la ración normal de laboratorio tendían a ser obesos y desarrollaban diabetes tipo 2, por lo cual se convirtieron en el foco de estudio de los biólogos

interesados en comprender la diabetes en los humanos.

Sin embargo, en todo este tiempo el misterio de por qué estos animales son tan susceptibles a la enfermedad no ha sido resuelto.

Algunos científicos pensaron encontrar una respuesta en la proteína PDX1 la cual tiene muchos roles incluidos el desarrollo del páncreas y el encendido y apagado del gen de la insulina.

Este gen es tan importante por esa razón que se encuentra en todos los vertebrados  pero los estudios genéticos no pudieron detectarlo en los Jird gordos.

Sin embargo tienen un páncreas normal y pueden secretar insulina lo cual no tiene sentido.

Lo científicos  decidieron secuenciar todo el genoma de este animal y descubrieron algo aún más desconcertante.

PDX1 no era el único gen que faltaba.

De hecho una gran parte del ADN que contiene casi 90 genes que se encuentran en el mismo cromosoma en otros animales, no se veía por ningún lado. muchos de estos genes como PDX1 son esenciales para la supervivencia entonces ¿dónde están?

La gran pista se obtuvo al examinar transcripciones de ADN  

El código genético está compuesto por cuatro bases: A, T, G y C

Lo que hizo que las secuencias en estas transcripciones fueran tan extrañas fue el muy alto nivel de dos de ellas:

G y C

Esto no había sido visto antes

Se encontró también un punto de acceso a la mutación una región de ADN con un número extraordinariamente grande de mutaciones, muchas de las cuales cambian de A o T , o a G o a base C.

También es extremadamente raro que los vertebrados tengan mutaciones en esa región.

Las mutaciones generalmente comprometen la función de un gen y los genes en ese pedazo de ADN oscuro difícil de detectar son tan esenciales para la supervivencia que apenas han cambiado a lo largo de la evolución.

Sin embargo alguna manera el gen PDX1 del Jird gordo junto con otros, están logrando funcionar a pesar de los dramáticos niveles de mutación.

Este descubrimiento está obligando a los científicos a revisar algunas ideas que tienen sobre la evolución como el cuántos cambios puede tolerar un gen y  aún así seguir funcionando.

Es más, la genética es una principales razones por las cuales estamos seguros de que la evolución es un hecho

La evolución ocurre en dos etapas: la mutación se sigue de  la variación en el ADN de un organismo,  la selección natural decide si se mantiene o si se va y eso le da una dirección a la evolución, pero la mutación dentro de un genoma en ciertos lugares tienen una mayor probabilidad de mutar que otros

Esto significa que estos puntos de acceso podrían ser un mecanismo que también podría influenciar en la evolución

O sea puede que la selección natural no sea la única fuerza motriz después de todo.

Hasta ahora el ADN oscuro parece estar presente en dos tipos de animales muy diversos y distintos porque también se ha descubierto ADN oscuro en ciertas aves.

Pero no está tan claro que tan extendido podría ser esto.

¿Podrían todos los genomas animales contener ADN oscuro? si no es así, ¿qué es lo que hace tan especial al Jird gordo y a algunas aves?

El mayor misterio va a ser ahora resolver la duda de qué efecto ha tenido el ADN oscuro a lo largo de la evolución en toda la historia de la vida.

Evolución biológicaBiologíaCienciaRelacionadosMás de El Robot de Platón

8 abril 2021

ADN genetico ADN BASURA O LOS DOS

Filed under: GENES — Enrique Rubio @ 21:10

ADN GENETICO ADN BASURA O LOS DOS

Hasta hace muy poco tiempo, se creía, que solo un pequeño porcentaje del ADN,  alrededor del 5%, producía genes y un terrible 95%, era simplemente ADN basura.

El conocimiento esta mostrando que este ADN basura es el regulador del ADN proyectivo. Pero aún es muy discutida la posible función de muchas secuencias que sólo se transcriben en ARN o que, por unirse a proteínas o determinar cambios de conformación de la cromatina, pueden tener función reguladora sobre los genes que dan proteínas.

En nuestros genes, no hay nada desechable, todo es útil. Pero también es posible que parte de el, sean virus que el organismo organiza y utiliza.

El estudio del antiguo ADN basura esta resultando , simplemente maravilloso y los resultados de este conocimiento, pueden ser valiosos a nivel terapéutico.

En 2015 el proyecto titulado GTEx (Genome-Tissue Expresion project) LOZCALIZABA  muchas regiones del genoma humano que determinan cambios en la expresión de los genes “normales” en los distintos tejidos y órganos de personas sanas y que, sobre todo, con sus variaciones de unas personas a otras pueden estar en la base de enfermedades como el cáncer.. Aquí lo que se analiza no es el genoma sino sus productos, el llamado transcriptoma, ARN y proteínas.

El estudio de los  ARN DE INTERFERENCIA (ARNI), muestran un proyecto de utlidad

El ARN interferente (en inglés interfering RNA), es una molécula de ARN que suprime la expresión de genes específicos mediante mecanismos conocidos globalmente como ribointerferencia o interferencia por ARN (RNA interference, RNAi).

El ARN de interferencia (ARNi) es un mecanismo biológico, ampliamente distribuido en eucariotas, por el cual, se consigue silenciar genes, mediante moléculas de ARN de doble cadena (ARNdc).

 El descubrimiento de este mecanismo, se llevó hace poco más de 15 años y, desde entonces, se han realizado diferentes investigaciones enfocadas, principalmente, a comprender mejor cómo funciona, su función en diferentes organismos, su uso para describir funciones de genes específicos y las potenciales aplicaciones que tendría en el desarrollo tecnológico, en otras áreas de la ciencia. El silenciamiento de genes se da por la interacción de complejos enzimáticos en el citoplasma con pequeñas moléculas de ARN (siRNA), las cuales, actúan sobre el ARN mensajero (ARNm) endógeno, impidiendo que sea traducido a proteína. Es un hecho que el ARNi puede ser una tecnología alternativa en el control de plagas de importancia agrícola, a través del silenciamiento selectivo de genes, considerados esenciales para la sobrevivencia de la plaga. La implementación de esta tecnología involucra una serie de estudios, que van desde la identificación de genes blanco, el diseño de secuencias de ARNdc, el desarrollo de bioensayos y pruebas en campo, que permitan evidenciar los reales efectos del silenciamiento y la evaluación de factores asociados, que pudieran generar variabilidad del proceso de silenciamiento, investigaciones que son necesarias para que esta tecnología se establezca, finalmente, en el mercado. El presente artículo presenta las bases teóricas del ARNi, los logros de esta tecnología, así como su potencial para el control de insectos plaga.

Tipos de ARN interferente

Los ARN interferentes son moléculas pequeñas (de 20 a 25 nucleótidos) que se generan por fragmentación de precursores más largos. Se pueden clasificar en tres grandes grupos de moléculas:2

siRNA

El acrónimo siRNA proviene del inglés small interfering RNA: en español, ARN interferente pequeño. Son moléculas de ARN bicatenario perfectamente complementarias de aproximadamente 20 o 21 nucleótidos (nt) con 2 nucleótidos desemparejados en cada extremo 3′. Cada hebra de ARN tiene un grupo fosfato 5′ y un grupo hidroxilo (-OH) 3′. Esta estructura proviene del procesamiento llevado a cabo por Dicer, una enzima que corta moléculas largas de ARN bicatenario (dsRNA, double stranded RNA) en varios siRNA.3​ Una de las hebras del siRNA (la hebra ‘antisentido’) se ensambla en un complejo proteico denominado RISC (RNA-induced silencing complex), que utiliza la hebra de siRNA como guía para identificar el ARN mensajero complementario. El complejo RISC cataliza el corte del ARNm complementario en dos mitades, que son degradadas por la maquinaria celular, bloqueando así la expresión del gen. Los siRNA pueden ser también introducidos de forma exógena en las células utilizando métodos de transfección basándose en la secuencia complementaria de un gen en particular, con la finalidad de reducir significativamente su expresión.

miRNA

Los microARN (en inglés, micro-RNA o miRNA) son pequeños ARN interferentes que se generan a partir de precursores específicos codificados en el genoma, que al transcribirse se pliegan en horquillas (hairpins) intramoleculares que contienen segmentos de complementariedad imperfecta. El procesamiento de los precursores ocurre generalmente en dos etapas, catalizado por dos enzimas, Drosha en el núcleo y Dicer en el citoplasma. Una de las hebras del miRNA (la hebra ‘antisentido’), como ocurre con los siRNA, se incorpora a un complejo similar al RISC. Dependiendo del grado de complementariedad del miRNA con el ARNm, los miRNA pueden bien inhibir la traducción del ARNm o bien inducir su degradación. Sin embargo, a diferencia con la vía de los siRNA, la degradación de ARNm mediada por miRNA se inicia con la eliminación enzimática de la cola de poli(A) del ARNm.

piRNA

(Piwi-interacting RNAs, ARN asociados a Piwi4​): se generan a partir de precursores largos monocatenarios, en un proceso que es independiente de Drosha y Dicer. Estos ARN pequeños se asocian con una subfamilia de las proteínas ‘Argonauta’ denominada proteínas Piwi. Se han identificado decenas de miles de piRNA, pero su función es desconocida (2008). Sin embargo, se sabe que conjuntamente con las proteínas Piwi, son necesarios para el desarrollo de las células de la línea germinal.

La tecnología del ARN de interferencia (ARNi) permite tratar muchas áreas terapéuticas diferentes. Actúa sobre cualquier enfermedad que conlleve una sobreexpresión de una proteína, como es el caso de la amiloidosis por transtiretina.

“Esta proteína mutada se deposita en los tejidos y causa daños, y lo que hace el ARNi es inhibir la expresión del gen de la transtiretina, ahí es donde tienen lugar este tipo de terapias”, puntualiza.

La principal característica de estos fármacos es la “selectividad”, inhibe la transcripción de un gen concreto, impidiendo la producción de una proteína en concreto que puede causar una patología”.

La tecnología del ARNi es extrapolable a “cualquier enfermedad donde queramos reducir la expresión de una proteína en concreto”.

 Y teóricamente es utilizable en  áreas terapéuticas de mayor prevalencia como la hipercolesterolemia u otras más estudiadas como la hemofilia, teniendo en cuenta que tiene más aplicaciones

Se las empezó a utilizar en determinadas proteínas del hígado y ahora  se empieza a aplicar esta tecnologa en el sistema nervioso central o al ocular y lógicamente aumentara el numero de patologías donde esta indicada la inhibición de determinadas proteínas nocivas. El ARN interferente (en inglés interfering RNA), es una molécula de ARN que suprime la expresión de genes específicos mediante mecanismos conocidos globalmente como ribointerferencia o interferencia por ARN (RNA interference, RNAi).

En general, el proceso de RNAi implica varios tipos de pequeñas secuencias de ARN «guía» que regulan los niveles de la proteína diana al direccionar para su degradación el ARNm de esta. En los seis estudios indicados, algunos siRNA procedentes de pseudogenes generan dos de las cuatro categorías de siRNA naturales (o endo-siRNA):

– la primera categoría de endo-siRNA media el silenciamiento de transposones, que es una característica de los piRNA. A diferencia de los piRNA, que constan de 24 a 30 nucleótidos y utilizan Piwi como proteína efectora, los endo-siRNA de primera categoría tienen de 21 a 22 nt, y utlilizan Ago2.

– la segunda categoría se genera mediante la transcripción bidireccional de loci parcialmente superpuestos en hebras opuestas de ADN.710​ Se han identificado unos 1000 endo-siRNA de este tipo en moscas, y estudios en ratones muestran algunos ejemplos.1112​ Los genes diana de esta categoría de endo-siRNA están relacionados con funciones de los ácidos nucleicos, como actividad nucleasa o unión a factores de transcripción.

– la tercera categoría de endo-siRNA se ha detectado solo en ratones1112​ y son el producto de la interacción de un ARNm transcrito a partir de un gen que codifica una proteína y un transcrito anti-sentido a partir del pseudogén correspondiente, que puede estar localizado lejos del gen codificante, en el mismo cromosoma o en otro.

– los endo-siRNA de la cuarta categoría están muy relacionados con los de la tercera: se generan a partir de secuencias en forma de horquilla (hairpin), que en ratón pueden proceder de las estructuras en repetición invertida de los pseudogenes. En este caso, el pseudogén también regula su gen codificante, pero el precursor de ARN bicatenario procede de la transcripción de una secuencia con repeticiones invertidas que dan lugar a una horquilla.

Los manuscritos indicados muestran que las proteínas de ratón afectadas por las categorías tercera y cuarta de endo-siRNA están generalmente implicadas en funciones específicas —como la regulación de la dinámica del citoesqueleto— lo que indica que la regulación subyacente mediada por pseudogenes ha sido seleccionada expresamente para ello, y no generada simplemente por el apareamiento al azar de tránscritos de genes y pseudogenes.

También se han encontrado precursores en horquilla de endo-siRNA en moscas, pero hay pocas evidencias que los relacionen con pseudogenes. La mayor parte de los endo-siRNA asociados con pseudogenes, por tanto, se han detectado en ratones. Una posible explicación es que el genoma de ratón contiene muchos más pseudogenes que el genoma de la mosca.15

Sin embargo, para demostrar de forma concluyente la actividad de los pseudogenes, son necesarios más experimentos (por ejemplo, eliminar un pseudogén y demostrar el efecto sobre el gen codificante potencialmente regulado por el pseudogén).

Como se indicaba al principio, además de conectar pseudogenes y RNAi, estos estudios también hacen más difusas las diferencias entre los tres tipos «tradicionales» de ARN interferentes (siRNA, miRNA y piRNA), que son distintos en su biogénesis y en sus funciones celulares. Estos estudios indican que los endo-siRNA regulan transposones (como los piRNA), que pueden generarse a partir de estructuras en horquilla (como los miRNA) y que, en moscas, su procesamiento implica un cofactor similar al de los miRNA.

El hecho de que las líneas de separación entre los distintos tipos de ARN interferente sean más difusas, unido a las nuevas conexiones entre pseudogenes y siRNA, tiene interesantes consecuencias evolutivas. En plantas se ha propuesto que las duplicaciones invertidas de un gen codificante podrían ser un mecanismo de generación de nuevos miRNA.16​ De esta forma, algunos endo-siRNA codificados por pseudogenes podrían proporcionar una conexión intermedia para comprender la evolución de la regulación génica mediada por miRNA.17​ Aunque especulativa, un estudio reciente del contexto genómico de más de 300 miRNA loci en humanos ha identificado dos en pseudogenes,18​ lo que apoyaría dicha hipótesis.

Inmunidad Mediada por ARNi

El ARN de interferencia es una parte vital de la respuesta inmune a los virus y otros materiales genéticos diferentes a los del mismo organismo, especialmente en plantas, donde posiblemente previene la propagación de transposomas.

Plantas como Arabidopsis thaliana expresan múltiples cortadores homólogos que se especializan en reaccionar de maneras diferentes cuando la planta se expone a diferentes tipos de virus. Aún antes de que la síntesis de ARNi fuera completamente comprendida, ya se sabía que la inducción del silenciamiento de genes en plantas se daba de manera sistémica y podía ser transferido de una planta a otra por medio de injertos. Se reconoce dicho fenómeno desde que se descubrió como un mecanismo de la planta del Sistema Inmunne Innato, y permite por completo a la planta responder a los virus después de su localización.

En respuesta a este mecanismo muchos virus de plantas han desarrollado mecanismo que suprimen la respuesta del ARNi, que incluyen proteínas virales que unen fragmentos cortos de ARN de doble cadena con fragmentos de cadena simple, eliminando los ARN virales. Algunos genomas de plantas expresan iARNs en respuesta a infecciones por tipos específicos de bacterias. Dichos efectos pueden ser parte de una respuesta generalizada que disminuye cualquier proceso metabólico en el huésped para disminuir el impacto de la infección.

Aunque los animales generalmente expresan algunas otras variantes de enzimas cortadoras a diferencia de las plantas, el ARNi en algunos animales ha demostrado tener respuesta antiviral. Tanto en la Drosophila juvenil como en la adulta, el ARNi es un importante antiviral del sistema inmune innato y está activo contra patógenos como el Virus X de Drosophila. Un rol similar de inmunidad puede operar en el Caenorhabditis elegans como proteínas argonautas que son hiper-reguladas en respuesta a virus y gusanos que sobre-expresan componentes de la síntesis de ARNi, por lo que son resistentes a infecciones virales.

El rol del ARNi en la inmunidad innata de mamíferos es pobremente comprendido, y hay poca información disponible. De cualquier manera, la existencia de virus que codifican genes capaces de suprimir la respuesta ARNi en células de mamíferos funciona como evidencia de sistemas inmunitarios ARNi-dependientes en mamíferos. Funciones alternativas de ARNi en virus de mamíferos existe también como miARNs expresados por el virus del Herpes, que probablemente actúe como un disparador de la organización de heterocromatina para medir su latencia viral.

Aplicación del ARNi en la terapia génica

El ARNi es un método para el silenciamiento de genes que puede ser aplicado en la terapia génica, con posibles aplicaciones en patologías como cáncer, infecciones virales y enfermedades neurodegenerativas y oculares. En el cáncer el blanco de ARNi son los oncogenes vinculados a la patología. Los objetivos de la terapia en el cáncer serían tres: ARNi para genes que forman parte de vías celulares vinculadas con el cáncer, para genes que participan en las interacciones tumor-huésped y para genes que están involucrados en la resistencia a quimioterapia y radioterapia. Para el caso de las infecciones virales el ARNi inhibe la expresión de genes virales, que interrumpen la replicación viral, causando la interrupción del ciclo de vida viral o bien el cese del mismo. En los desórdenes neurodegenerativos, la aplicación de los ARNi sería dirigirlos a las secuencias específicas causantes de la enfermedad, algunas de las enfermedades que pueden ser tratadas son: Enfermedad de HuntingtonEnfermedad de Parkinson, ataxías y Enfermedad de Alzheimer. Para el caso de los síndromes oculares los ARNi pueden ser usados para infusiones intraoculares.19RNAi and gene therapy: a mutual attraction.20“TERAPIA GÉNICA CON RNA DE INTERFERENCIA”

un caso de uso de ARNi es en el estudio del gusano pantera de tres bandas, para poder determinar a través de este método que genes se están expresando,por inhibición de su funcionalidad. 21

.

Referencias

 Hammond SM, Bernstein E, Beach D, Hannon GJ. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature. 2000 Mar 16;404(6775):293-6 [1]

 Grosshans H, Filipowicz W. Molecular biology: the expanding world of small RNAs.Nature. 2008 Jan 24;451(7177):414-6 [2]

 Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature. 2001 Jan 18;409(6818):363-6 [3]

 Hartig JV, Tomari Y, Förstemann K. (2007). «piRNAs–the ancient hunters of genome invaders.». Genes Dev. 21 (14). 1707-13. [4]

 Saltar a:a b Saumet A, Lecellier CH (2006). «Anti-viral RNA silencing: do we look like plants?». Retrovirology 3 (3): 3. PMID 16409629doi:10.1186/1742-4690-3-3.

 Jones L, Ratcliff F, Baulcombe DC (2001). «RNA-directed transcriptional gene silencing in plants can be inherited independently of the RNA trigger and requires Met1 for maintenance»Current Biology 11 (10): 747-757. doi:10.1016/S0960-9822(01)00226-3.

 Czech B, Malone CD, Zhou R, Stark A, Schlingeheyde C, Dus M, Perrimon N, Kellis M, Wohlschlegel JA, Sachidanandam R, Hannon GJ, Brennecke J. An endogenous small interfering RNA pathway in Drosophila.Nature 2008 Jun 5;453(7196):798-802 [5]

 Ghildiyal M, Seitz H, Horwich MD, Li C, Du T, Lee S, Xu J, Kittler EL, Zapp ML, Weng Z, Zamore PD.Endogenous siRNAs derived from transposons and mRNAs in Drosophila somatic cells.Science 2008 May 23;320(5879):1077-81 [6]

Kawamura Y, Saito K, Kin T, Ono Y, Asai K, Sunohara T, Okada TN, Siomi MC, Siomi H.Drosophila endogenous small RNAs bind to Argonaute 2 in somatic cells.Nature 2008 Jun 5;453(7196):793-7 [7]

 Okamura K, Chung WJ, Ruby JG, Guo H, Bartel DP, Lai EC. The Drosophila hairpin RNA pathway generates endogenous short interfering RNAs.Nature 2008 Jun 5;453(7196):803-6 [8]

Tam OH, Aravin AA, Stein P, Girard A, Murchison EP, Cheloufi S, Hodges E, Anger M, Sachidanandam R, Schultz RM, Hannon GJ.Pseudogene-derived small interfering RNAs regulate gene expression in mouse oocytes.Nature 2008 May 22;453(7194):534-8 [9]

 Watanabe T, Totoki Y, Toyoda A, Kaneda M, Kuramochi-Miyagawa S, Obata Y, Chiba H, Kohara Y, Kono T, Nakano T, Surani MA, Sakaki Y, Sasaki H.Endogenous siRNAs from naturally formed dsRNAs regulate transcripts in mouse oocytes.Nature 2008 May 22;453(7194):539-43 [10]

Sasidharan R, Gerstein M. Protein fossils live on as RNA. Nature 2008 June 5;453(7196):729-31 [11]

 Zheng D, Frankish A, Baertsch R, Kapranov P, Reymond A, Choo SW, Lu Y, Denoeud F, Antonarakis SE, Snyder M, Ruan Y, Wei CL, Gingeras TR, Guigó R, Harrow J, Gerstein MB. Pseudogenes in the ENCODE regions: consensus annotation, analysis of transcription, and evolution.Genome Res. 2007 Jun;17(6):839-51 [12]

 Identification of pseudogenes in the Drosophila melanogaster genome.Nucleic Acids Res. 2003 Feb 1;31(3):1033-7 [13]

 Allen E, Xie Z, Gustafson AM, Sung GH, Spatafora JW, Carrington JC.Evolution of microRNA genes by inverted duplication of target gene sequences in Arabidopsis thaliana.Nature Genet. 2004 Dec;36(12):1282-90 [14]

 Chapman EJ, Carrington JC. Specialization and evolution of endogenous small RNA pathways.Nature Rev.Genet. 2007 Nov;8(11):884-96 [15]

 Devor EJ.Primate microRNAs miR-220 and miR-492 lie within processed pseudogenes.J.Hered.2006 Mar-Apr;97(2):186-90 [16]

 Grimm D, Kay MA. (2007) «RNAi and gene therapy: a mutual attraction».Hematology Am Soc Hematol Educ Program :473-81.

  Morales SMA. (2010): “TERAPIA GÉNICA CON RNA DE INTERFERENCIA”.

 Gehrke, Andrew R.; Neverett, Emily; Luo, Yi-Jyun; Brandt, Alexander; Ricci, Lorenzo; Hulett, Ryan E.; Gompers, Annika; Ruby, J. Graham et al. (15 de marzo de 2019). «Acoel genome reveals the regulatory landscape of whole-body regeneration»Science (en inglés) 363 (6432). ISSN 0036-8075PMID 30872491doi:10.1126/science.aau6173. Consultado el 23 de enero de 2020.

20 enero 2021

LA IMPORTANCIA DEL CRISPR

Filed under: General,GENES,genetica — Enrique Rubio @ 13:24

Las maneras más innovadoras de utilizar el CRISPR

El científico estadounidense James Wason y el británico Francis Crick culminaron su descubrimiento de la estructura molecular del ADN, en forma de doble hélice. Ese hallazgo revolucionó entonces la ciencia, al permitir entender cómo funciona la molécula portadora del programa genético de los organismos vivos. Ahora, esto tiene implicaciones aún más profundas gracias a la tecnología de edición de genes CRISPR —las siglas en inglés de repeticiones palindrómicas cortas agrupadas y regularmente espaciadas—, que permite a los científicos cortar y alterar con precisión el ADN de cualquier célula.

Aunque CRISPR —también conocido como “tijera molecular”— aún no ha curado enfermedades ni ha acabado con el hambre en el mundo, ya se está utilizando de algunas maneras sorprendentes.

Convertir cerdos en donantes de órganos

Durante décadas, la mejor solución que han concebido los científicos para reducir la lista de las miles de personas que esperan recibir un trasplante de órganos en todo el mundo ha sido utilizar órganos de animales en humanos. Por ejemplo, el primer trasplante de corazón se realizó en 1964, cuando el órgano de un chimpancé fue implantado en un humano, que falleció dos horas después de la cirugía.

Además de que el cuerpo humano rechaza tejidos extraños, otro riesgo de esa alternativa es la posibilidad de que las infecciones de los animales puedan transmitirse a los receptores humanos. Pero la empresa eGenesis, que nació en el laboratorio del genetista George Church de la Universidad de Harvard, cree que el CRISPR puede resolver o eliminar estos obstáculos.

La empresa eGenesis ha utilizado la edición genética para eliminar una familia de virus que se encuentran en el ADN de los cerdos. Crédito: eGenesis

El equipo de Church ha utilizado la edición genética para eliminar una familia de virus que se encuentran en el ADN de los cerdos, para que estos —cuyos pulmones y el corazón son de tamaño similar a los de los humanos— puedan ser donantes a personas sin riesgo de contaminación.

La compañía también está experimentando con CRISPR para modificar los genes relacionados con el sistema inmunológico y evitar que el cuerpo humano rechace los órganos de donantes. Sin embargo, los científicos advierten que todavía quedan algunos años para que se pueda hacer un ensayo clínico de trasplantes humanos con órganos producidos en cerdos genéticamente modificados.

Alternativas a la insulina

Las personas con diabetes tipo 2 (resistente a la insulina) podrían tener una opción para sustituir las inyecciones con un injerto de piel. Se trataría de un injerto que contiene una versión modificada por CRISPR de una proteína que ayuda a la insulina a regular los niveles de glucosa en la sangre. Investigadores de la Universidad de Chicago están utilizando CRISPR para para alterar el gen GLP-1, responsable de la codificación de la hormona péptido 1, que provoca la liberación de insulina y luego ayuda a eliminar el exceso de glucosa de la sangre.

Usando CRISPR, los científicos han comprobado que el gen GLP-1 podría modificarse para que sus efectos de regulación tengan larga duración. Cerca del 80% de los injertos de piel que se aplicaron en ratones liberaron con éxito la hormona editada en la sangre, regulando los niveles de glucosa durante cuatro meses y revirtiendo la resistencia a la insulina y el aumento de peso en los pacientes.

Investigadores de la Universidad de Chicago están utilizando CRISPR para para alterar el gen GLP-1. Crédito: University of Chicago

Los tratamientos en humanos tardarán tiempo en desarrollarse, pero la buena noticia es que los científicos ya pueden hacer crecer el tejido de la piel muy fácilmente en el laboratorio utilizando células madre. La previsión es que esa técnica pueda tratar también enfermedades como la hemofilia (cuando el cuerpo no puede hacer los coágulos de sangre de manera adecuada).

Acabar con enfermedades endémicas

Las enfermedades transmitidas por mosquitos, especialmente la malaria, matan a más de 400.000 personas cada año en todo el mundo. Para reducir esa cifra, algunos científicos proponen utilizar una tecnología llamada unidad genética. Se trata de una herramienta de ingeniería genética diseñada para diseminar ciertos genes a través de una especie. Y aunque no es una idea nueva, estas unidades de genes están más cerca de ser realidad gracias al CRISPR.

En un artículo publicado en septiembre de 2018, los investigadores del Imperial College de Londres mostraron que una unidad genética realizada con CRISPR podría suprimir una población de Anopheles gambiae, el tipo de mosquito que transmite la malaria en el África subsahariana. Los investigadores utilizaron el “corta y pega” genético para atacar el gen Doublesex, responsable por el desarrollo femenino. Cuando los mosquitos hembra heredaron dos copias de este gen modificado, no pudieron picar ni poner huevos.

Una unidad genética realizada con CRISPR podría suprimir una población de Anopheles gambiae, el mosquito que transmite la malaria. Crédito: James D. Gathany

Los investigadores pusieron esos mosquitos en jaulas y encontraron que eran autodestructivos para su especie en su entorno cercano: después de ocho generaciones, ya no quedaban hembras normales para reproducirse y la población se extinguió.

Ese tipo de experimentos no han sido realizados fuera de los laboratorios todavía —existe la posibilidad de que las alteraciones genéticas diseñadas para impactar las poblaciones puedan mutar y transmitir rasgos ventajosos a las demás generaciones—, pero ese estudio comprobó que se transmitió la modificación genética casi el 100% de las veces, evitando la resistencia.

Líderes de la Unión Africana respaldaron la investigación como un esfuerzo por combatir la malaria en sus países, pero aún podrían pasar años antes de que la tecnología se pruebe en la naturaleza.

Cambiar el color de las flores

La herramienta de edición genética interrumpió con éxito el gen responsable del color de los tallos, las hojas y los pétalos. Fuente: Nature

Científicos japoneses están utilizando CRISPR para cambiar el color de la flor de una planta de jardín tradicional (Ipomoea nil). Los investigadores programaron CRISPR para atacar un gen específico, conocido como gen DFR-B y lo insertaron en embriones de plantas.

La herramienta de edición de genes interrumpió con éxito el gen DFR-B, que es responsable del color de los tallos, las hojas y los pétalos, cambiando así el color violeta característico de la flor al blanco.

Joana Oliveira

16 enero 2021

UN AVANCE DE LA TECNICA CRISPR

Filed under: GENES,genetica — Enrique Rubio @ 22:04

EL Dr Mujica, hizo un descubrimiento extraordinario al señalar y cortar una secuencia de ADN patologico, y poder intercalar otro ADN normal, en levaduras de la Sal en Alicante

Pero recientemente , se ha simplificado la técnica, que en vez de recortar la secuencia patológica de ADN, añade al genoma del paciente una copia en buen estado del gen dañado, para que recupere su función normal y la enfermedad remita.

CRISPR-Cas9 actúa como unas tijeras que cortan la doble hélice del ADN, lo que a veces puede desencadenar cambios no deseados en las letras o bases (A, T, G, C) que escriben el genoma. Si se consiguen eliminar esos “efectos secundarios”. La técnica, cambiaria la estrategia de “cortar y pegar” por un sistema de edición de textos -“buscar y reemplazar”- de tal precisión, que en teoría podría corregir alrededor del 89% de las variantes genéticas humanas asociadas con enfermedades.
“Si CRISPR son las tijeras, los editores de bases serían el lápiz: en lugar de cortar la doble hélice, convierten una letra del ADN en otra, sin llegar a romper la doble cadena, lo que permite corregir los principales tipos de mutaciones de forma eficiente, pero no todas. El editor ‘prime’ supondría el sistema de ‘búsqueda y sustitución’ de un procesador de texto; permite realizar directamente mutaciones puntuales específicas, inserciones y eliminaciones de una sola letra y combinaciones de estas, también sin tener que romper la doble cadena”, La tecnología de edición genética CRISPR-Cas9 ha revolucionado la investigación biológica y médica, al proporcionar la herramienta más sencilla con la que editar el ADN. Su potencial es enorme: desde corregir mutaciones asociadas a enfermedades a obtener plantas más resistentes para el cultivo.

La gran innovación de esta técnica prime consiste en la fusión de la proteína Cas9 –que es la encargada de cortar el ADN en el sistema de edición clásico– con una enzima de transcriptasa inversa –molécula que genera ADN a partir de ARN- y la modificación de la guía de ARN para que, a la vez que localiza el sitio que se quiere editar, actúe de molde para corregira la mutación. De esta forma, se evita la rotura de doble cadena.
Los científicos han probado la técnica con más de 175 ediciones genéticas en células humanas, incluida la corrección del error que causa la anemia de células falciformes y la enfermedad de Tay Sachs, una patología por depósito lisosomal que afecta al sistema nervioso central. Según exponen en el artículo, la técnica es muy eficiente y produce menos “efectos secundarios” que la clásica CRISPR-Cas9.
Pero esta investigación es un “cambio revolucionario” que se produce en la técnica del CRISPR.
Este trabajo ofrece , un método robusto de corrección de alelos patogénicos Y abre un gran número de posibilidades biotecnológicas. Permite corregir pequeños alelos con un nivel de certidumbre más alto que métodos anteriores y en un rango de condiciones muy grande (incluyendo células que se dividen poco). También parece que tiene un nivel bajo de off-target (ediciones fuera de diana)”. Güell considera que si bien el CRISPR-Cas9 clásico funciona muy bien “para romper o inactivar genes”, el editor prime parece “bastante superior para corregir” errores genéticos. Y, además, “potencialmente es más seguro”, al evitar la rotura de doble cadena de ADN.

Los resultados de una nueva tecnología llamada Uni-large, desarrollada para modificar el genoma para hacer frente a diversas enfermedades de manera más segura y eficiente que otras soluciones, están ya en fase de revisión para su publicación, ha explicado a Diario Médico Marc Güell, investigador principal de este proyecto en el Grupo de Investigación en Biología Sintética Traslacional del Departamento de Ciencias Experimentales y de la Salud (DCEXS) de la Universidad Pompeu Fabra (UPF) de Barcelona.

Uni-large está pensada para tratar las enfermedades de origen genético y algunos tipos de cáncer derivados del mal funcionamiento de un gen (como la leucemia, por ejemplo). Según información de la UPF, consiste en añadir al genoma del paciente una copia en buen estado del gen dañado, para que recupere su función normal y la enfermedad remita. La universidad ha patentado esta tecnología y previsto su protección a la par que ha creado una empresa, Integra Therapeutics, que desarrollará y comercializará los programas terapéuticos vinculados a ella, ha precisado Güell.

Inicialmente el equipo está probando su utilidad en el tratamiento de la distrofia muscular congénita tipo 1A (MDC1A), una enfermedad hereditaria para la que no existe ninguna terapia efectiva. Se trata de la distrofia muscular congénita más frecuente y provoca debilidad progresiva y pérdida de la masa muscular.

Entre las ventajas de Uni-large destaca su universalidad puesto que otras técnicas de edición genética, como la CRISPR, pueden corregir mutaciones individuales de cada paciente (medicina personalizada), mientras que la nueva tecnología sería útil con todos los pacientes de una determinada enfermedad. Además, con CRISPR hay que hacer un corte en el genoma para reparar la mutación, lo que puede provocar accidentes como la pérdida o la rotura de cromosomas, mientras que con Uni-large no se corta, sólo se pega un gen, lo que evita riesgos. Además, el método es especialmente útil con enfermedades como la MDC1A donde el gen implicado es muy grande y otras tecnologías no permiten reparaciones eficientes.

Güell recalca especialmente que Uni-large es de la misma familia de la tecnología CRISPR, pero la suya está pensada para poner un gen entero; es decir, permite escalar “muy bien”, lo cual la hace universal.

 Inmediatamente ha surgido una modificación

Explica que hace años, tras una estancia en Estados Unidos, empezó a trabajar en la idea de combinar la precisión de las tecnologías modernas pero sin perder de vista la clásica. Probaron con células en cultivos y se fueron realizando ajustes hasta llegar a un modelo de ratón con distrofia muscular donde ya se ha visto que funciona “bastante bien”.

Fue Francis Mojica, quien realizó la primeras contribuciones​ que describían las secuencias repetidas CRISPR en arqueas y su papel en los mecanismos de inmunidad de las células procariotas. Sus descubrimientos cristalizaron más tarde en el desarrollo de la tecnología CRISPR-Cas.

Referencia
Sonia Moreno Biología Molecular
Carmen Fernández. Barcelona 21 octubre, 2019

Marc Güell, en el edificio del PRBB de Barcelona. 16/01/2021 –

23 febrero 2020

Los telómeros María Blasco

Filed under: GENES — Enrique Rubio @ 14:17

LOS TELÓMEROS
“ La bióloga María Blasco , directora del Centro Nacional de Investigaciones Oncológicas (CNIO), que ha dedicado toda su carrera a estudiar los telómeros y a aclarar qué relación tienen con el cáncer y la longevidad. En una de sus últimas investigaciones, publicada en la revista PNAS , ha averiguado cómo los telómeros regulan la longevidad de las especies.
Creo que los investigadores en general se lo pasan muy bien buscando. Cuando leo los estudios de los investigadores y sobre todo investigadoras y el placer que le produce no solo el hallazgo, sino sobre todo la búsqueda, siento verdadera envidia y me siento todo lo feliz que yo puedo ser, porque he llegado a mayor y sigo enamorado de las ciencias sobre todo del sistema nervioso y sobre todo de la biología de éste y de la conexión entre lo orgánico y lo psíquico. Todo esto me parece tan hermoso, que tengo tendencia a rechazar las novelas y el culto que alrededor de ellas se ha establecido. Quiero preocuparme por verdades útiles, y caiga quien caiga. La publicidad dice que en España se publican cada año aproximadamente 84 mil libros. Y le pido a los escritores y publicadores, que no me señalen como inculto si no me los leo todos o casi todos.
Me interesan aquellos libros que me aportan conocimientos útiles, y si me olvidó de alguna historia de amor, pues vale me lo perdí, Dios proveerá.
Pero lo que no quiero perderme es como María Blasco me cuenta para que sirven los telómeros en los cromosomas, por ejemplo.
¿Qué son los telómeros?
El ADN se organiza en cromosomas en el núcleo de nuestras células. Los telómeros son estructuras que se encuentran en los extremos de los cromosomas y que protegen el material genético. Son importantísimos para la vida porque, sin telómeros, las células no podrían vivir. Pero se acortan a medida que las células se multiplican y envejecemos. Cuanto más cortos son los telómeros, más enfermedades se producen y mayor es el riesgo de muerte.
El estudio de los telómeros mostraba algo desconcertante. Las personas, que tienen larga vida comparándola con otros animales, tienen los telómeros relativamente cortos.
Los ratones, que viven mucho menos tiempo, tienen los telómeros mucho más largos. Y también los telómeros de los ratones se acortan más rápido que los nuestros. Esto llevó a pensar que tal vez lo importante no era la longitud de los telómeros sino la velocidad de acortamiento.
Las personas, que tenemos vidas largas en comparación con otros animales, tenemos los telómeros cortos”
La Dr.ª María Blasco se enfrentó con el problema con toda la energía que ella tiene y con la pasión que pone en sus estudios.
Al principio sólo teníamos las observaciones de humanos y ratones. Para comprobar si era una regla general, necesitábamos datos de más animales. Nos pusimos en contacto con el zoo de Madrid y con Carola Sanpera, una bióloga de la Universidad de Barcelona que trabaja con gaviotas salvajes en el delta del Ebro. Así obtuvimos muestras de delfines, renos, elefantes, flamencos, buitres… En total, nueve especies de aves y mamíferos.
Nos hubiera gustado incluir reptiles, anfibios y peces… Llegamos a medir los telómeros de dos tortugas, pero necesitábamos más individuos para tener datos fiables de la velocidad de acortamiento de los telómeros según la edad, por lo que no las incluimos en el análisis.
También sería muy interesante estudiar los telómeros en árboles, hay especies que viven varios siglos. Pero en este estudio analizamos la longitud de los telómeros en células de la sangre. Los árboles no tienen sangre, así que los resultados no hubieran sido comparables.
La velocidad a la que se acortan los telómeros es más importante que su longitud inicial”
Al comparar los telómeros de estas nueve especies?
El primer resultado es que no hay ninguna relación entre la longitud de los telómeros al nacer y la longevidad de una especie. Lo que habíamos visto en ratones y humanos se confirmó en las otras especies. Entre las que analizamos, los delfines mulares son los que nacen con telómeros más largos. Después vienen, por este orden, ratones, elefantes de Sumatra, gaviotas de Audouin… Y los más cortos son los de las cabras y las personas.
La velocidad de acortamiento de los telómeros, se ajusta perfectamente a una ley potencial, que es una relación matemática que nos indica la longevidad de una especie a partir de la velocidad a la que se acortan los telómeros. Es válida tanto para las aves como para los mamíferos que hemos estudiado. Hemos visto, por ejemplo, que flamencos y elefantes tienen la misma longevidad y la misma velocidad de acortamiento de los telómeros, pese a que son especies evolutivamente muy distantes y de tamaños muy diferentes.
Las especies grandes como elefantes y ballenas suelen vivir más que las pequeñas como conejos y ratones. Pero nuestros resultados indican que el acortamiento de los telómeros es más relevante que el tamaño.
El estrés crónico, que aumenta el riesgo de numerosas enfermedades, acelera el acortamiento de los telómeros”
¿El acortamiento de los telómeros es causa sin duda del envejecimiento?
En experimentos con ratones en que se les han acortado los telómeros, se les ha acelerado el envejecimiento. Y, al revés, cuando hacemos que los ratones tengan telómeros largos durante más tiempo, también hacemos que vivan más.
¿Puede ser el mecanismo que ha encontrando la evolución para regular la longevidad de las especies?
Creemos que hemos identificado un mecanismo biológico fundamental y de momento común a todas las especies que hemos estudiado. Pero tendríamos que estudiar una muestra más amplia de especies para hacer una afirmación categórica. Y nos gustaría estudiar cómo las condiciones ambientales en que vive un animal afectan al acortamiento de los telómeros y a la longevidad, como ya se ha visto que ocurre en personas.
Sería muy interesante estudiar los telómeros en árboles, hay especies que viven varios siglos”
¿En personas?
Elizabeth Blackburn [que ganó el premio Nobel por sus investigaciones sobre los telómeros] demostró que el estrés crónico, que aumenta el riesgo de numerosas enfermedades, acelera el acortamiento de los telómeros.
¿Se podría predecir la esperanza de vida de una persona a partir de los telómeros?
Podrían ser un biomarcador de envejecimiento. Está en estudio si tienen valor pronóstico para algunas enfermedades de manera similar a cómo ahora utilizamos el colesterol como indicador de riesgo cardiovascular. En un futuro podría tener sentido medir la longitud de los telómeros de una persona a distintas edades para calcular la velocidad de acortamiento y para estudiar el impacto de los estilos de vida sobre los telómeros.
Lo millones de elemento que tiene el sistema nervioso humano nos llevan continuamente a una nueva búsqueda.
Un investigador tiene que tener mucho cuidado con el pensamiento romántico. Que yo lo defino como “ si esto ha sido así, pues lo próximo tiene que ser de esta otra manera”. Esta situación es siempre errónea , no hay nunca un tras esto viene esto otro.
Detrás del último no va nadie, ¿pero por cuánto tiempo?
Mi enhorabuena a María Blasco que se emborracha con el conocimiento.

Telómero básico

Filed under: GENES — Enrique Rubio @ 14:12

Telómero básico

Un cromosoma (izquierda) y un telómero (a la derecha).
Los telómeros (del griego τέλος [telos], «final», y μέρος [meros], «parte») son los extremos de los cromosomas. Son regiones de ADN no codificante, altamente repetitivas, cuya función principal es la estabilidad estructural de los cromosomas en las células eucariotas, la división celular y el tiempo de vida de las estirpes celulares. Además están involucradas en enfermedades tan importantes como el cáncer.
Los organismos procariotas tienen cromosomas circulares que no poseen telómeros. Algunos procariotas poseen cromosomas lineales con secuencias teloméricas, cuya secuencia es diferente a la de eucariotas.

Los telómeros fueron descubiertos por Hermann Joseph Muller durante la década de los años 30 del siglo XX, que junto a Barbara McClintock recibieron el Premio Nobel. Desde entonces, se ha avanzado mucho en el conocimiento de los telómeros, gracias a las técnicas de genética molecular. Proponían que los telómeros, situados en los extremos de los cromosomas, tenían la función de prevenir que éstos se fusionaran al ponerse en contacto por sus extremos, lo que produciría consecuencias desastrosas para las células.
Los científicos Elizabeth H. Blackburn, Carol W. Greider y Jack W. Szostak son reconocidos con el Premio Nobel de medicina en 2009 por la descripción molecular de los telómeros, la demostración de su conservación evolutiva y el descubrimiento de la telomerasa, enzima central de la maquinaria celular para la síntesis del telómero, por haber logrado un muy consistente modelo que explica el ‘problema de la terminación de la replicación’ (end-replication problem) y el mecanismo molecular de protección de los extremos cromosomales.
En los cromosomas existen dos tipos de ADN: el ADN codificante, que constituye los genes, es decir, porciones del cromosoma donde se encuentra la información que codifica las proteínas, el Ácido ribonucleico de transferencia y los ácidos ribonucleicos ribosomales, disperso entre una gran cantidad de ADN no codificante. Entre el ADN no codificante se encuentran el que forma el centrómero y los telómeros de los cromosomas. El centrómero es una porción alargada de ADN que permite que la molécula del ADN se fije al huso mitótico durante la fase M del ciclo celular. Por su parte, los telómeros juegan un importante papel en la vida de las células ya que mantienen la integridad de las terminaciones de los cromosomas impidiendo que se enmarañen y adhieran unos con otros, ayudan a que los cromosomas homólogos se emparejen y entrecrucen durante la profase de la meiosis. Los telómeros humanos y murinos[cita requerida] contienen hasta 2.000 veces repetida la secuencia 5′ TTAGGG 3′:
5’…TTAGGG TTAGGG TTAGGG TTAGGG TTAGGG TTAGGG..3′
3’…AATCCC AATCCC AATCCC AATCCC AATCCC AATCCC..5′
Algunas teorías del envejecimiento y de la carcinogénesis se basan en que los telómeros son como los relojes o temporizadores de la célula, ya que marcan el número de divisiones celulares, hasta que la célula muere. Los fundamentos de estas teorías son:
El ADN contenido en los telómeros no se replica completamente durante la duplicación del ADN, ya que los enzimas ADN polimerasa solo pueden trabajar en dirección 5′->3′. Para una de las dos hebras (conductora) esto no supone problema, pero para poder duplicar simultáneamente la hebra retrasada (que se presenta en dirección 3′->5′) deben formarse los fragmentos de Okazaki. El inicio de cada segmento está constituido por un primer de ARN. Estos son finalmente sustituidos por ADN, sin embargo, el primer del extremo 5′ de la hebra no puede ser completado, ya que se requeriría trabajar en dirección 3′->5′. Como consecuencia, el telómero que se va haciendo cada vez más y más corto en cada replicación.
Los telómeros, en la mayoría de las especies animales y vegetales y en los microorganismos, están constituidos por subunidades cortas de nucleótidos generalmente ricos en timina (T) y guanina (G). En los humanos la secuencia de cada una de estas subunidades es TTAGGG.
El número de repeticiones es variable según las distintas células de un mismo individuo; sin embargo el promedio de repeticiones suele ser constante para cada especie. En una persona se calcula que alcanza aproximadamente las 2.000 repeticiones. Según Consulosky Slater.[cita requerida]
La telomerasa es una enzima formada por un complejo proteína-ácido ribonucleico con actividad transcripatasa inversa (es decir, puede sintetizar ADN a partir de una secuencia de ARN que ella misma porta), que es producida en células germinales embrionarias que permite el alargamiento de los telómeros.
La telomerasa es reprimida en las células somáticas maduras después del nacimiento, lo que producen un acortamiento del telómero después de cada división celular.
Cuando la longitud del telómero alcanza cierto límite, se interrumpen las mitosis quedando las células en el estadio G0 (G Cero) de su ciclo celular.
El desgaste del telómero en el transcurso de ciclos celulares, impide su función protectora del cromosoma, con lo que éste se vuelve inestable, se fusiona o se pierde. Las células que presentan estos defectos, no sólo son incapaces de duplicarse, sino que dejan de ser viables y se activan los procesos de apoptosis o muerte celular programada.
Muchas células cancerosas reactivan la actividad de telomerasa, favoreciendo la proliferación de un clon maligno. Se están estudiando fármacos que inhiben la telomerasa y así detener el crecimiento de las células malignas, por lo que podría ser una nueva diana terapéutica del cáncer[cita requerida].
Especialistas del Centro Nacional de Investigaciones Oncológicas (CNIO), han desarrollado un tratamiento que actúa sobre los genes que, aplicado en animales adultos, una única vez, consigue de manera segura alargar la vida media de los individuos. Este tipo de investigaciones obligaba a modificar permanentemente los genes de los animales desde la fase embrionaria. Sin embargo, la terapia génica desarrollada por el CNIO para combatir el envejecimiento ha sido probada en ratones adultos de uno y dos años, y tuvo un efecto «rejuvenecedor» sobre ellos.
El procedimiento consiste en tratar modificar la carga genética de un virus cuyo ADN ha sido modificado; sus genes se sustituyen por uno de los genes más importantes para el envejecimiento de las especies tratadas: el que codifica la enzima telomerasa. La telomerasa frena este efecto, reconstruye los telómeros y corrige el reloj biológico de la célula. El virus con el ADN tratado e inoculado en el animal actúa como un vehículo que deposita el gen de la telomerasa en las células.1
La ADN polimerasa sólo puede fabricar nuevas hebras de ADN cuando se mueve a lo largo de la cadena molde, polimerizando nucléotidos en la dirección 5′ → 3′ (sobre una hebra molde de polaridad 3′ → 5′). Esto no plantea ningún problema para la hebra denominada «contínua» de un cromosoma, dado que la polimerasa se puede mover libre e ininterrumpidamente desde del origen de replicación hasta el final del cromosoma o hasta que encuentra una señal de terminación. No ocurre lo mismo cuando la hebra molde es la de direccionalidad 5´ → 3′ cuya replicación debe ser forzosamente discontinua, dado que el complejo de replicación se mueve coordinadamente sobre las dos hebras parentales, de direccionalidades opuestas. Cuando la horquilla de replicación se ha abierto lo suficiente, la ADN-polimerasa sintetiza un fragmento del ADN complementario en el sentido contrario al del avance del complejo de replicación. Luego de formarse este fragmento, la síntesis de un nuevo cebador da comienzo a la polimerización de un nuevo fragmento, y así sucesivamente. Más tarde, estos fragmentos de ADN (llamados fragmentos de Okazaki) serán empalmados mediante una ligasa.
Sin embargo, al llegar al final del cromosoma, el último fragmento de Okazaki queda a una distancia del extremo de su hebra molde que resulta insuficiente para el agregado de un nuevo cebador. Por esta razón, la cadena discontinua no se puede completar y se produce un acortamiento asimétrico (es decir, sólo en la hebra hija) del telómero. Durante cada replicación, el proceso se repite, acortando progresivamente los telómeros en ambos extremos del cromosoma. Se estima que las células humanas pierden unos 100 pares de bases de ADN telomérico en cada replicación. Esto representa unos 16 fragmentos TTAGGG. Teniendo en cuenta el número inicial de estas secuencias, al cabo de unas 125 divisiones mitóticas, el telómero se ha perdido completamente
La pregunta es: ¿es debido a esto que en las células somáticas, después de un número determinado de divisiones, la célula muere?
Los experimentos de Hayflick mostraron que las células normales (no cancerosas) no crecen in vitro de forma indefinida pese a suministrarle todos los nutrientes y factores de crecimiento necesarios. Las células obtenidas de recién nacidos cultivadas in vitro experimentan unas 100 divisiones, mientras que células obtenidas de sujetos mayores, solo se dividen unas 20 a 24 veces.2 ¿Es esto debido a los telómeros que representan como un reloj que determina la longevidad de las células?
A favor de esta hipótesis está el hecho de que algunas células son inmortales, como las células germinales, las células eucariotas unicelulares (como el Paramecium) o algunas células tumorales. En todas ellas existe una enzima, denominada telomerasa que después de cada división reinstaura la integridad de los telómeros.
La telomerasa (TERT)
Es una transcriptasa inversa que sintetiza ADN a partir de un molde de ARN. Se trata de una ribonucleoproteína que contiene en su molécula la secuencia AAUCCC capaz de crear e insertar los fragmentos TTAGGG que se pierden en cada división. En 1998, Bodnar y col introdujeron en dos tipos de células humanas normales, telomerasa-negativas, el gen que codifica la telomerasa. En contraste con las células normales que mostraban senescencia y un acortamiento de los telómeros, los clones expresando la TERT mostraron telómeros elongados, se dividían vigorosamente y mostraron una reducción de la beta-galactosidasa, un biomarcador de la senescencia. Las células transformadas para expresar la TERT mostraron un cariotipo normal y su longevidad ha superado la normal en más de 20 divisiones.
Muchas células cancerosas derivan de células somáticas, y se ha comprobado la presencia de telomerasa en el 75-80% de las líneas tumorales. Esto no quiere decir que la telomerasa induzca el cáncer. Es más, Kathleen Collins de la Universidad de Califormia en Berkeley,[cita requerida] encontró que pacientes con una enfermedad congénita muy poco frecuente, la disqueratosis congénita, tenían niveles de telomerasa anormalmente bajos, muriendo no obstante en muchos casos de cáncer gastrointestinal. A pesar de esta incongruencia, se sabe que la agresividad de las células tumorales está relacionada con sus niveles de telomerasa y que niveles altos de esta enzima son indicativos de la malignidad del tumor. Recientemente la FDA ha autorizado dos estudios clínicos con telomerasa, uno de ellos encaminado a obtener un mejor diagnóstico del cáncer cervical y el otro para evaluar un fármaco contra la leucemia mieloide.[cita requerida]
En Japón, se está siendo utilizado en niños con neuroblastoma 4S. Al parecer estos niños tienen un cáncer metastásico, pero los tumores son telomerasa negativos y aproximadamente el 80% llegan a una remisión espontánea una vez que el tumor ha sido eliminado quirúrgicamente. El estudio identifica los que son telomerasa-positivos, de manera que puedan ser tratados de una manera más agresiva.
Algunas secuencias conocidas de telómeros[editar]
Algunas secuencias conocidas de telómeros
Grupo Organismo Secuencia del telómero (Dirección 5’a 3′ hasta el fin)
Protozoos ciliados
Tetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Protozoos apicomplejos
Plasmodium
TTAGGG(T/C)
Plantas superiores
Arabidopsis thaliana
TTTAGGG
Algas verdes
Chlamydomonas
TTTTAGGG
Protozoos cinetoplástidos
Trypanosoma, Crithidia
TTAGGG
Mohos del fango
Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Hongos filamentosos
Neurospora crassa
TTAGGG
Vertebrados
Humanos, ratón, Xenopus
TTAGGG
Ascáridos
Ascaris lumbricoides
TTAGGC
Insectos
Bombyx mori
TTAGG
Levaduras aisladas
Schizosaccharomyces pombe
TTAC(A)(C)G(1-8)
Levaduras agregadas Saccharomyces cerevisiae
Candida glabrata
Candida albicans
Candida tropicalis
Candida maltosa
Candida guillermondii
Candida pseudotropicalis
Kluyveromyces lactis
TGTGGGTGTGGTG (de copias de ARN)
or G(2-3)(TG)(1-6)T (consenso)
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTA[C/A]GGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT
Referencias
Blackburn, E. H. 1991. Structure and entonces tener to take entonces tener to take function of telomeres. Nature 350:569-72.
Witzany, G. 2008. The Viral Origins of Telomeres and Telomerases and their Important Role in Eukaryogenesis and Genome Maintenance. Biosemiotics 1: 191-206.
Toftgård, Rune. 2009. Maintenance of chromosomes by telomeres and the enzyme telomerase.The Nobel Assembly at Karolinska Institutet – The Nobel Prize in Physiology or Medicine [1]

Older Posts »

Powered by WordPress