Enriquerubio.net El blog del Dr. Enrique Rubio

24 febrero 2020

EL CEREBRO DE UN PSICÓPATA

Filed under: Emocion y Sentimientos — Enrique Rubio @ 12:29

COMO ES EL CEREBRO DE UN PSICÓPATA
Una revisión científica sugiere que el estrés emocional en la infancia precipita la sobremaduración de algunas regiones cerebrales y dificulta la gestión de las emociones
La alteración de la estructura para explicar la alteración de la función es la constante en neurobiología El cerebro de un psicópata es diferente, son seres que tienen total falta de empatía, saben lo que esta bien y lo que está mal pero no les afecta el dolor ni los sentimientos de otras personas.
Múltiples estudios se han hecho sobre este tema de los que mencionaré algunos
La Universidad de Wisconsin-Madison ha descubierto que el cerebro de los psicópatas es diferente del resto

El cerebro de los psicópatas presenta indicios de una hipermaduración acelerada durante la infancia, hecho que los protege del sufrimiento, pero dificulta que gestionen sus emociones, aunque son plenamente conscientes de sus actos, según un estudio publicado en Psychological Medicine.
“El psicópata puede ser el resultado de un estrés emocional en las primeras fases de la vida, que provoca la hipermaduración de las estructuras del cerebro implicadas en los sentimientos y la toma de decisiones”, explica el doctor Jesús Pujol.
El especialista es director de investigación de la Unidad de Resonancia Magnética del Servicio de Radiología del Hospital del Mar y del Instituto Hospital del Mar de Investigaciones Médicas (IMIM) y CIBERSAM.
Investigadores del Hospital del Mar de Barcelona y del Parc Taulí de Sabadell también descubrieron que el cerebro de los psicópatas es parecido al de personas que consumen esteroides durante un largo periodo de tiempo.

Los científicos analizaron el cerebro de personas con psicopatías mediante imágenes obtenidas con resonancia magnética para comprobar que sufren una hipermaduración o maduración acelerada de determinadas zonas del cerebro, hecho que afecta a su capacidad para gestionar las emociones.
La investigación ha analizado más de 400 artículos publicados en revistas científicas, ha comprobado que el factor emocional temprano tiene una gran influencia en el desarrollo, formación y comportamiento del psicópata.
El psicópata puede ser el resultado de un estrés emocional en las primeras fases de la vida, que provoca la hipermaduración de las estructuras del cerebro implicadas en los sentimientos y la toma de decisiones.
Los investigadores lo explican por la aparente reducción de la sustancia gris detectada en las imágenes por resonancia magnética, que es debida a un proceso de mielinización excesiva o incremento de sustancia blanca, compatible con esta maduración acelerada.
Las zonas más afectadas son el sistema frontal-basal y temporal anterior y el frontal medial y cíngulo posterior, que relacionan los estímulos externos con las reacciones y los sentimientos.
Esta alteración tiene efectos secundarios en forma de falta de escrúpulos y de remordimientos, no tienen freno emocional”, según Pujol.
Esta diferencia respecto a un cerebro normal, según el investigador, “no afecta a su capacidad de razonamiento, tienen sentimientos, a pesar de parecer fríos emocionalmente”.

Jiménez Martínez, C. 2017. No es mi culpa, fue mi cerebro. ¿Es esta una afirmación válida para aplicar la inimputabilidad a individuos con trastornos de la personalidad y psicópatas?. Derecho Penal y Criminología. 37, 103 (jul. 2017), 81-107. DOI:https://doi.org/10.18601/01210483.v37n103.05.

«Los psicópatas son personas con problemas de relación interpersonal y de gestión de las emociones. Aparentemente son fríos, aunque tienen emociones muy intensa pero no tienen remordimientos, que es lo que da una tendencia hacia la delincuencia, en algunos casos»,
Una revisión científica de otros estudios publicados y ha constatado que el cerebro de los psicópatas es distinto. La investigación apunta a que el estrés emocional en la infancia precipita la sobremaduración de algunas regiones cerebrales como un sistema de protección contra el sufrimiento, pero termina dificultando también la gestión de las
La complejidad de la psicopatía va más allá de los estereotipos. Lo que sí parece cierto es que tienen diferencias cerebrales estructurales
. Pujol y su equipo revisaron más de 400 artículos científicos en los que se había analizado el cerebro de las personas con psicopatía a través de resonancias magnéticas. El metaanálisis, publicado en la revista científica Psychological Medicine, ha concluido que el cerebro de los psicópatas presenta una maduración acelerada de varias regiones cerebrales relacionadas con el procesamiento emocional y el cognitivo. «El cerebro de los psicópatas es diferente desde el punto de vista anatómico y funcional. Hay diferencias en las áreas que procesan la cognición y el razonamiento y en las que procesan la actividad emocional. La conexión entre estas dos áreas falla», explica Pujol.
Los investigadores encontraron que, desde el punto de vista anatómico, en las regiones de lóbulo temporal (donde está la amígdala, relacionada con la emociones) y en el frontal (encargado de las funciones cognitivas) había «una aparente atrofia de la sustancia gris». «Sin embargo, lo que luego nosotros postulamos es que, en realidad, lo que había era un aumento de la sustancia blanca, lo que implica una sobremaduración de esas áreas»,.
En la práctica, esta alteración cerebral provoca que, ante un dilema moral, la activación de los dos sistemas (el cognitivo y el emocional) se bloquee. Ni su capacidad de razonamiento ni sus sentimientos o emociones están anulados. Lo que ocurre es que «la asociación entre emoción y cognición en la toma de decisiones está bloqueada», aclara el médico. Con todo, señala, «son responsables de sus actos».
Los investigadores han encontrado también similitudes entre los cerebros de los psicópatas y las personas que consumen durante más de 10 años esteroides androgénicos
Esta similitud no implica que los consumidores de esteroides acaben desarrollando, a largo plazo, un trastorno psicopático. «Hay una semejanza anatómica de las dos patologías. Si bien es cierto que el control de los impulsos y la conducta pueden cambiar tras consumir esteroides durante largos períodos de tiempo,

23 febrero 2020

El cerebro de los delincuentes depende del tiempo de enfermedad

Filed under: depresion demencias — Enrique Rubio @ 21:16

Los delincuentes tienen un cerebro diferente según el tiempo de actuación

Múltiples investigadores se han agrupado integrado buscando un prototipo en el cerebro de los delincuentes, y hasta ahora no se han encontrado datos objetivos que puedan hacer un diagnóstico estructural y de localización este trabajo ofrece la posibilidad de que la actuación transitoria de estos enfermos puede redimirlos

Un estudio ha encontrado variaciones fisiológicas en comparación con aquellos que no transgredieron la ley o que solo lo hicieron durante la adolescencia
La mayoría de adolescentes que cometen delitos dejan de hacerlo en la edad adulta (South_agency / Getty Images/iStockphoto)
Los padres no deberían preocuparse mucho si sus hijos quebrantan la ley de adolescentes, siempre que se hayan comportado bien en su primera infancia. Así lo afirma un estudio publicado en la revista The Lancet Psychiatry . En él se sugiere que aquellos que continúan delinquiendo a lo largo de su vida ya mostraban un comportamiento antisocial desde una edad temprana y presentan una estructura cerebral marcadamente diferente de los que no lo hacen.
La adolescencia es una fase del desarrollo a veces un poco tormentosa en la que los jóvenes buscan la independencia de los adultos y algunos pueden llegar a cometer delitos para reafirmar esta independencia. Trabajos anteriores han demostrado que el crimen aumenta en esta etapa pero la mayoría de los perpetradores se convierten en adultos respetuosos de la ley y solo una minoría, menos del 10% de la población general, continúa delinquiendo durante toda su vida.

Los delincuentes presentan una estructura cerebral diferente (Charité – Universitätsmedizin Berlin)
Con anterioridad ya había sido señalado el desarrollo anormal del cerebro como un aspecto fundamental del comportamiento antisocial persistente durante el curso de la vida. Esta investigación, según afirman los autores en el artículo, da un paso más y permite definir diferentes trayectorias de este tipo de comportamiento desde la infancia.
“Los hallazgos reiteran investigaciones previas que realmente resaltan que existen diferentes tipos de delincuentes juveniles. No todos deberían ser tratados de la misma manera ”, declaró a The Guardian la coautora del estudio Essi Viding, profesora de Psicopatología del Desarrollo en el University College de Londres (Inglaterra).
Para llevar a cabo la investigación, el equipo empleó datos de 672 personas nacidas en Nueva Zelanda entre abril de 1972 y marzo de 1973. Se recopilaron registros detallados del comportamiento antisocial de los participantes a intervalos regulares desde los siete años hasta los 26 años. A los 45 años se les escaneó el cerebro mediante resonancia magnética funcional.

El equipo dividió a los participantes en tres grupos según su historial de comportamiento antisocial: 441 mostraron pocos signos de tal comportamiento, 151 solo fueron antisociales en la adolescencia y 80 ya mostraron un comportamiento antisocial en la infancia.
Los escáneres cerebrales de adultos con un largo historial de transgresiones mostraban una superficie más pequeña en muchas áreas del cerebro en comparación con aquellos con un historial limpio.
Su materia gris era más delgada en regiones vinculadas a la regulación de las emociones, la motivación y el control del comportamiento, aspectos de la conducta con los que habían tenido problemas. Aquellos que habían sido delincuentes solo en la adolescencia también mostraron algunas diferencias en esta medida en comparación con los que respetaron la ley.
Para los autores los delincuentes de largo recorrido operan bajo alguna desventaja a nivel del cerebro (LightFieldStudios / Getty Images/iStockphoto)
La profesora de Psicología en la Universidad de Duke (EE.UU.)Terrie Moffitt, también autora de la investigación, afirmaba en el mismo periódico que el estudio ha ayudado a arrojar luz sobre lo que podría estar detrás de un comportamiento antisocial persistente.
“Pudo haber sido simplemente que el grupo que mantuvo esta conducta eligió llevar sus vidas de una manera más difícil y podría haber elegido de manera diferente. Yo creo que lo que vemos con estos datos es que en realidad están operando bajo alguna desventaja a nivel del cerebro”, dijo la profesora.
El equipo señala en base a los resultados que se necesita hacer más para identificar a los niños con signos de comportamiento antisocial y así ofrecerles apoyo tanto a ellos como a sus padres, una medida que para los autores podría reducir el crimen en un futuro.
Sin embargo, qué es la causa y qué el efecto en los delincuentes persistentes no está del todo claro. Según los investigadores, los factores genéticos y ambientales, como una infancia con carencias, pueden haber moldeado sus cerebros en etapas tempranas de la vida.
También es posible que otros factores posteriores, como el tabaquismo, el abuso de alcohol o drogas, hayan causado los cambios cerebrales. De hecho, de todos los grupos, el que seguía delinquiendo en la edad adulta era el que presentaba mayores tasas de consumo de sustancias adictivas

REDACCIÓN
18/02/2020 18:12 | Actualizado a 18/02/2020 19:22

Los telómeros María Blasco

Filed under: GENES — Enrique Rubio @ 14:17

LOS TELÓMEROS
“ La bióloga María Blasco , directora del Centro Nacional de Investigaciones Oncológicas (CNIO), que ha dedicado toda su carrera a estudiar los telómeros y a aclarar qué relación tienen con el cáncer y la longevidad. En una de sus últimas investigaciones, publicada en la revista PNAS , ha averiguado cómo los telómeros regulan la longevidad de las especies.
Creo que los investigadores en general se lo pasan muy bien buscando. Cuando leo los estudios de los investigadores y sobre todo investigadoras y el placer que le produce no solo el hallazgo, sino sobre todo la búsqueda, siento verdadera envidia y me siento todo lo feliz que yo puedo ser, porque he llegado a mayor y sigo enamorado de las ciencias sobre todo del sistema nervioso y sobre todo de la biología de éste y de la conexión entre lo orgánico y lo psíquico. Todo esto me parece tan hermoso, que tengo tendencia a rechazar las novelas y el culto que alrededor de ellas se ha establecido. Quiero preocuparme por verdades útiles, y caiga quien caiga. La publicidad dice que en España se publican cada año aproximadamente 84 mil libros. Y le pido a los escritores y publicadores, que no me señalen como inculto si no me los leo todos o casi todos.
Me interesan aquellos libros que me aportan conocimientos útiles, y si me olvidó de alguna historia de amor, pues vale me lo perdí, Dios proveerá.
Pero lo que no quiero perderme es como María Blasco me cuenta para que sirven los telómeros en los cromosomas, por ejemplo.
¿Qué son los telómeros?
El ADN se organiza en cromosomas en el núcleo de nuestras células. Los telómeros son estructuras que se encuentran en los extremos de los cromosomas y que protegen el material genético. Son importantísimos para la vida porque, sin telómeros, las células no podrían vivir. Pero se acortan a medida que las células se multiplican y envejecemos. Cuanto más cortos son los telómeros, más enfermedades se producen y mayor es el riesgo de muerte.
El estudio de los telómeros mostraba algo desconcertante. Las personas, que tienen larga vida comparándola con otros animales, tienen los telómeros relativamente cortos.
Los ratones, que viven mucho menos tiempo, tienen los telómeros mucho más largos. Y también los telómeros de los ratones se acortan más rápido que los nuestros. Esto llevó a pensar que tal vez lo importante no era la longitud de los telómeros sino la velocidad de acortamiento.
Las personas, que tenemos vidas largas en comparación con otros animales, tenemos los telómeros cortos”
La Dr.ª María Blasco se enfrentó con el problema con toda la energía que ella tiene y con la pasión que pone en sus estudios.
Al principio sólo teníamos las observaciones de humanos y ratones. Para comprobar si era una regla general, necesitábamos datos de más animales. Nos pusimos en contacto con el zoo de Madrid y con Carola Sanpera, una bióloga de la Universidad de Barcelona que trabaja con gaviotas salvajes en el delta del Ebro. Así obtuvimos muestras de delfines, renos, elefantes, flamencos, buitres… En total, nueve especies de aves y mamíferos.
Nos hubiera gustado incluir reptiles, anfibios y peces… Llegamos a medir los telómeros de dos tortugas, pero necesitábamos más individuos para tener datos fiables de la velocidad de acortamiento de los telómeros según la edad, por lo que no las incluimos en el análisis.
También sería muy interesante estudiar los telómeros en árboles, hay especies que viven varios siglos. Pero en este estudio analizamos la longitud de los telómeros en células de la sangre. Los árboles no tienen sangre, así que los resultados no hubieran sido comparables.
La velocidad a la que se acortan los telómeros es más importante que su longitud inicial”
Al comparar los telómeros de estas nueve especies?
El primer resultado es que no hay ninguna relación entre la longitud de los telómeros al nacer y la longevidad de una especie. Lo que habíamos visto en ratones y humanos se confirmó en las otras especies. Entre las que analizamos, los delfines mulares son los que nacen con telómeros más largos. Después vienen, por este orden, ratones, elefantes de Sumatra, gaviotas de Audouin… Y los más cortos son los de las cabras y las personas.
La velocidad de acortamiento de los telómeros, se ajusta perfectamente a una ley potencial, que es una relación matemática que nos indica la longevidad de una especie a partir de la velocidad a la que se acortan los telómeros. Es válida tanto para las aves como para los mamíferos que hemos estudiado. Hemos visto, por ejemplo, que flamencos y elefantes tienen la misma longevidad y la misma velocidad de acortamiento de los telómeros, pese a que son especies evolutivamente muy distantes y de tamaños muy diferentes.
Las especies grandes como elefantes y ballenas suelen vivir más que las pequeñas como conejos y ratones. Pero nuestros resultados indican que el acortamiento de los telómeros es más relevante que el tamaño.
El estrés crónico, que aumenta el riesgo de numerosas enfermedades, acelera el acortamiento de los telómeros”
¿El acortamiento de los telómeros es causa sin duda del envejecimiento?
En experimentos con ratones en que se les han acortado los telómeros, se les ha acelerado el envejecimiento. Y, al revés, cuando hacemos que los ratones tengan telómeros largos durante más tiempo, también hacemos que vivan más.
¿Puede ser el mecanismo que ha encontrando la evolución para regular la longevidad de las especies?
Creemos que hemos identificado un mecanismo biológico fundamental y de momento común a todas las especies que hemos estudiado. Pero tendríamos que estudiar una muestra más amplia de especies para hacer una afirmación categórica. Y nos gustaría estudiar cómo las condiciones ambientales en que vive un animal afectan al acortamiento de los telómeros y a la longevidad, como ya se ha visto que ocurre en personas.
Sería muy interesante estudiar los telómeros en árboles, hay especies que viven varios siglos”
¿En personas?
Elizabeth Blackburn [que ganó el premio Nobel por sus investigaciones sobre los telómeros] demostró que el estrés crónico, que aumenta el riesgo de numerosas enfermedades, acelera el acortamiento de los telómeros.
¿Se podría predecir la esperanza de vida de una persona a partir de los telómeros?
Podrían ser un biomarcador de envejecimiento. Está en estudio si tienen valor pronóstico para algunas enfermedades de manera similar a cómo ahora utilizamos el colesterol como indicador de riesgo cardiovascular. En un futuro podría tener sentido medir la longitud de los telómeros de una persona a distintas edades para calcular la velocidad de acortamiento y para estudiar el impacto de los estilos de vida sobre los telómeros.
Lo millones de elemento que tiene el sistema nervioso humano nos llevan continuamente a una nueva búsqueda.
Un investigador tiene que tener mucho cuidado con el pensamiento romántico. Que yo lo defino como “ si esto ha sido así, pues lo próximo tiene que ser de esta otra manera”. Esta situación es siempre errónea , no hay nunca un tras esto viene esto otro.
Detrás del último no va nadie, ¿pero por cuánto tiempo?
Mi enhorabuena a María Blasco que se emborracha con el conocimiento.

Telómero básico

Filed under: GENES — Enrique Rubio @ 14:12

Telómero básico

Un cromosoma (izquierda) y un telómero (a la derecha).
Los telómeros (del griego τέλος [telos], «final», y μέρος [meros], «parte») son los extremos de los cromosomas. Son regiones de ADN no codificante, altamente repetitivas, cuya función principal es la estabilidad estructural de los cromosomas en las células eucariotas, la división celular y el tiempo de vida de las estirpes celulares. Además están involucradas en enfermedades tan importantes como el cáncer.
Los organismos procariotas tienen cromosomas circulares que no poseen telómeros. Algunos procariotas poseen cromosomas lineales con secuencias teloméricas, cuya secuencia es diferente a la de eucariotas.

Los telómeros fueron descubiertos por Hermann Joseph Muller durante la década de los años 30 del siglo XX, que junto a Barbara McClintock recibieron el Premio Nobel. Desde entonces, se ha avanzado mucho en el conocimiento de los telómeros, gracias a las técnicas de genética molecular. Proponían que los telómeros, situados en los extremos de los cromosomas, tenían la función de prevenir que éstos se fusionaran al ponerse en contacto por sus extremos, lo que produciría consecuencias desastrosas para las células.
Los científicos Elizabeth H. Blackburn, Carol W. Greider y Jack W. Szostak son reconocidos con el Premio Nobel de medicina en 2009 por la descripción molecular de los telómeros, la demostración de su conservación evolutiva y el descubrimiento de la telomerasa, enzima central de la maquinaria celular para la síntesis del telómero, por haber logrado un muy consistente modelo que explica el ‘problema de la terminación de la replicación’ (end-replication problem) y el mecanismo molecular de protección de los extremos cromosomales.
En los cromosomas existen dos tipos de ADN: el ADN codificante, que constituye los genes, es decir, porciones del cromosoma donde se encuentra la información que codifica las proteínas, el Ácido ribonucleico de transferencia y los ácidos ribonucleicos ribosomales, disperso entre una gran cantidad de ADN no codificante. Entre el ADN no codificante se encuentran el que forma el centrómero y los telómeros de los cromosomas. El centrómero es una porción alargada de ADN que permite que la molécula del ADN se fije al huso mitótico durante la fase M del ciclo celular. Por su parte, los telómeros juegan un importante papel en la vida de las células ya que mantienen la integridad de las terminaciones de los cromosomas impidiendo que se enmarañen y adhieran unos con otros, ayudan a que los cromosomas homólogos se emparejen y entrecrucen durante la profase de la meiosis. Los telómeros humanos y murinos[cita requerida] contienen hasta 2.000 veces repetida la secuencia 5′ TTAGGG 3′:
5’…TTAGGG TTAGGG TTAGGG TTAGGG TTAGGG TTAGGG..3′
3’…AATCCC AATCCC AATCCC AATCCC AATCCC AATCCC..5′
Algunas teorías del envejecimiento y de la carcinogénesis se basan en que los telómeros son como los relojes o temporizadores de la célula, ya que marcan el número de divisiones celulares, hasta que la célula muere. Los fundamentos de estas teorías son:
El ADN contenido en los telómeros no se replica completamente durante la duplicación del ADN, ya que los enzimas ADN polimerasa solo pueden trabajar en dirección 5′->3′. Para una de las dos hebras (conductora) esto no supone problema, pero para poder duplicar simultáneamente la hebra retrasada (que se presenta en dirección 3′->5′) deben formarse los fragmentos de Okazaki. El inicio de cada segmento está constituido por un primer de ARN. Estos son finalmente sustituidos por ADN, sin embargo, el primer del extremo 5′ de la hebra no puede ser completado, ya que se requeriría trabajar en dirección 3′->5′. Como consecuencia, el telómero que se va haciendo cada vez más y más corto en cada replicación.
Los telómeros, en la mayoría de las especies animales y vegetales y en los microorganismos, están constituidos por subunidades cortas de nucleótidos generalmente ricos en timina (T) y guanina (G). En los humanos la secuencia de cada una de estas subunidades es TTAGGG.
El número de repeticiones es variable según las distintas células de un mismo individuo; sin embargo el promedio de repeticiones suele ser constante para cada especie. En una persona se calcula que alcanza aproximadamente las 2.000 repeticiones. Según Consulosky Slater.[cita requerida]
La telomerasa es una enzima formada por un complejo proteína-ácido ribonucleico con actividad transcripatasa inversa (es decir, puede sintetizar ADN a partir de una secuencia de ARN que ella misma porta), que es producida en células germinales embrionarias que permite el alargamiento de los telómeros.
La telomerasa es reprimida en las células somáticas maduras después del nacimiento, lo que producen un acortamiento del telómero después de cada división celular.
Cuando la longitud del telómero alcanza cierto límite, se interrumpen las mitosis quedando las células en el estadio G0 (G Cero) de su ciclo celular.
El desgaste del telómero en el transcurso de ciclos celulares, impide su función protectora del cromosoma, con lo que éste se vuelve inestable, se fusiona o se pierde. Las células que presentan estos defectos, no sólo son incapaces de duplicarse, sino que dejan de ser viables y se activan los procesos de apoptosis o muerte celular programada.
Muchas células cancerosas reactivan la actividad de telomerasa, favoreciendo la proliferación de un clon maligno. Se están estudiando fármacos que inhiben la telomerasa y así detener el crecimiento de las células malignas, por lo que podría ser una nueva diana terapéutica del cáncer[cita requerida].
Especialistas del Centro Nacional de Investigaciones Oncológicas (CNIO), han desarrollado un tratamiento que actúa sobre los genes que, aplicado en animales adultos, una única vez, consigue de manera segura alargar la vida media de los individuos. Este tipo de investigaciones obligaba a modificar permanentemente los genes de los animales desde la fase embrionaria. Sin embargo, la terapia génica desarrollada por el CNIO para combatir el envejecimiento ha sido probada en ratones adultos de uno y dos años, y tuvo un efecto «rejuvenecedor» sobre ellos.
El procedimiento consiste en tratar modificar la carga genética de un virus cuyo ADN ha sido modificado; sus genes se sustituyen por uno de los genes más importantes para el envejecimiento de las especies tratadas: el que codifica la enzima telomerasa. La telomerasa frena este efecto, reconstruye los telómeros y corrige el reloj biológico de la célula. El virus con el ADN tratado e inoculado en el animal actúa como un vehículo que deposita el gen de la telomerasa en las células.1
La ADN polimerasa sólo puede fabricar nuevas hebras de ADN cuando se mueve a lo largo de la cadena molde, polimerizando nucléotidos en la dirección 5′ → 3′ (sobre una hebra molde de polaridad 3′ → 5′). Esto no plantea ningún problema para la hebra denominada «contínua» de un cromosoma, dado que la polimerasa se puede mover libre e ininterrumpidamente desde del origen de replicación hasta el final del cromosoma o hasta que encuentra una señal de terminación. No ocurre lo mismo cuando la hebra molde es la de direccionalidad 5´ → 3′ cuya replicación debe ser forzosamente discontinua, dado que el complejo de replicación se mueve coordinadamente sobre las dos hebras parentales, de direccionalidades opuestas. Cuando la horquilla de replicación se ha abierto lo suficiente, la ADN-polimerasa sintetiza un fragmento del ADN complementario en el sentido contrario al del avance del complejo de replicación. Luego de formarse este fragmento, la síntesis de un nuevo cebador da comienzo a la polimerización de un nuevo fragmento, y así sucesivamente. Más tarde, estos fragmentos de ADN (llamados fragmentos de Okazaki) serán empalmados mediante una ligasa.
Sin embargo, al llegar al final del cromosoma, el último fragmento de Okazaki queda a una distancia del extremo de su hebra molde que resulta insuficiente para el agregado de un nuevo cebador. Por esta razón, la cadena discontinua no se puede completar y se produce un acortamiento asimétrico (es decir, sólo en la hebra hija) del telómero. Durante cada replicación, el proceso se repite, acortando progresivamente los telómeros en ambos extremos del cromosoma. Se estima que las células humanas pierden unos 100 pares de bases de ADN telomérico en cada replicación. Esto representa unos 16 fragmentos TTAGGG. Teniendo en cuenta el número inicial de estas secuencias, al cabo de unas 125 divisiones mitóticas, el telómero se ha perdido completamente
La pregunta es: ¿es debido a esto que en las células somáticas, después de un número determinado de divisiones, la célula muere?
Los experimentos de Hayflick mostraron que las células normales (no cancerosas) no crecen in vitro de forma indefinida pese a suministrarle todos los nutrientes y factores de crecimiento necesarios. Las células obtenidas de recién nacidos cultivadas in vitro experimentan unas 100 divisiones, mientras que células obtenidas de sujetos mayores, solo se dividen unas 20 a 24 veces.2 ¿Es esto debido a los telómeros que representan como un reloj que determina la longevidad de las células?
A favor de esta hipótesis está el hecho de que algunas células son inmortales, como las células germinales, las células eucariotas unicelulares (como el Paramecium) o algunas células tumorales. En todas ellas existe una enzima, denominada telomerasa que después de cada división reinstaura la integridad de los telómeros.
La telomerasa (TERT)
Es una transcriptasa inversa que sintetiza ADN a partir de un molde de ARN. Se trata de una ribonucleoproteína que contiene en su molécula la secuencia AAUCCC capaz de crear e insertar los fragmentos TTAGGG que se pierden en cada división. En 1998, Bodnar y col introdujeron en dos tipos de células humanas normales, telomerasa-negativas, el gen que codifica la telomerasa. En contraste con las células normales que mostraban senescencia y un acortamiento de los telómeros, los clones expresando la TERT mostraron telómeros elongados, se dividían vigorosamente y mostraron una reducción de la beta-galactosidasa, un biomarcador de la senescencia. Las células transformadas para expresar la TERT mostraron un cariotipo normal y su longevidad ha superado la normal en más de 20 divisiones.
Muchas células cancerosas derivan de células somáticas, y se ha comprobado la presencia de telomerasa en el 75-80% de las líneas tumorales. Esto no quiere decir que la telomerasa induzca el cáncer. Es más, Kathleen Collins de la Universidad de Califormia en Berkeley,[cita requerida] encontró que pacientes con una enfermedad congénita muy poco frecuente, la disqueratosis congénita, tenían niveles de telomerasa anormalmente bajos, muriendo no obstante en muchos casos de cáncer gastrointestinal. A pesar de esta incongruencia, se sabe que la agresividad de las células tumorales está relacionada con sus niveles de telomerasa y que niveles altos de esta enzima son indicativos de la malignidad del tumor. Recientemente la FDA ha autorizado dos estudios clínicos con telomerasa, uno de ellos encaminado a obtener un mejor diagnóstico del cáncer cervical y el otro para evaluar un fármaco contra la leucemia mieloide.[cita requerida]
En Japón, se está siendo utilizado en niños con neuroblastoma 4S. Al parecer estos niños tienen un cáncer metastásico, pero los tumores son telomerasa negativos y aproximadamente el 80% llegan a una remisión espontánea una vez que el tumor ha sido eliminado quirúrgicamente. El estudio identifica los que son telomerasa-positivos, de manera que puedan ser tratados de una manera más agresiva.
Algunas secuencias conocidas de telómeros[editar]
Algunas secuencias conocidas de telómeros
Grupo Organismo Secuencia del telómero (Dirección 5’a 3′ hasta el fin)
Protozoos ciliados
Tetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Protozoos apicomplejos
Plasmodium
TTAGGG(T/C)
Plantas superiores
Arabidopsis thaliana
TTTAGGG
Algas verdes
Chlamydomonas
TTTTAGGG
Protozoos cinetoplástidos
Trypanosoma, Crithidia
TTAGGG
Mohos del fango
Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Hongos filamentosos
Neurospora crassa
TTAGGG
Vertebrados
Humanos, ratón, Xenopus
TTAGGG
Ascáridos
Ascaris lumbricoides
TTAGGC
Insectos
Bombyx mori
TTAGG
Levaduras aisladas
Schizosaccharomyces pombe
TTAC(A)(C)G(1-8)
Levaduras agregadas Saccharomyces cerevisiae
Candida glabrata
Candida albicans
Candida tropicalis
Candida maltosa
Candida guillermondii
Candida pseudotropicalis
Kluyveromyces lactis
TGTGGGTGTGGTG (de copias de ARN)
or G(2-3)(TG)(1-6)T (consenso)
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTA[C/A]GGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT
Referencias
Blackburn, E. H. 1991. Structure and entonces tener to take entonces tener to take function of telomeres. Nature 350:569-72.
Witzany, G. 2008. The Viral Origins of Telomeres and Telomerases and their Important Role in Eukaryogenesis and Genome Maintenance. Biosemiotics 1: 191-206.
Toftgård, Rune. 2009. Maintenance of chromosomes by telomeres and the enzyme telomerase.The Nobel Assembly at Karolinska Institutet – The Nobel Prize in Physiology or Medicine [1]

22 febrero 2020

Lactoferrina

Filed under: INFECCIONES E INFLAMACION — Enrique Rubio @ 21:45

La lactoferrina acentúa las defensas para prevenir el coronavirus
El fundador de Sesderma anima a usar Lactyferrin Defense como una solución para reforzar el sistema inmunitario

Con la llegada del del coronavirus Covid 19 el miedo se apodera del mundo, y no tenemos otra escapada, que aislar al virus y aislarnos nosotros. Con respecto a la epidemia de gripe de 1918, la Gripe Española, lo único que superamos en nuestro tiempo a 1918, es la capacidad de organización y la comunicación. Que no es poco. Y esto está evitando por ahora una catástrofe.
Por eso cuando alguien nos ofrece un remedio aunque sea sutil nos alegra el ilusiona
La lactoferrina actúa en el organismo como una sustancia natural que forma parte de nuestro sistema inmunológico. “Lactyferrin Defense tiene multitud de propiedades, aunque la más destacable en el momento actual es que funciona como un potente antiviral”. Así lo afirma Gabriel Serrano, dermatólogo y fundador de los Laboratorios Sesderma, en una reciente charla que dio en la que apuntó a la lactoferrina liposomada como una solución pionera para la prevención y tratamiento del Covid-19, diversos virus y otras propiedades de la nanolactoferrina en patologías no infecciosas.
El coronavirus sigue amenazando a China y el número de personas afectadas sigue en aumento. Ante esta situación, Serrano, cuya empresa ha donado más de cien mil mascarillas en el país asiático, explicó las ventajas de la lactoferrina para prevenir el virus. “Sesderma tiene una solución muy efectiva contra el coronavirus, de hecho, ya estamos en contacto con las autoridades chinas de Wuhan y Lactyferrin ya está llegando a las zonas más afectadas. La perspectiva de cara al coronavirus es crear una vacuna, pero esto puede llevar al menos un año. Sin embargo, Lactyferrin va a contribuir notablemente a reducir los contagios y ayudar a los pacientes afectados”.
Como en la gripe y otras infecciones respiratorias, las medidas de carácter general y de aplicación individual, como el lavado de manos y la higiene respiratoria y ambiental, son las medidas más efectivas a poner en marcha. Sin embargo, el dermatólogo entiende que estas recomendaciones no son suficientes: “El protocolo de prevención que hemos creado con Lactyferrin Defense se administra por vía oral, que es el más idóneo, pero recientemente hemos encontrado una vía mucho más rápida y eficaz, a través del nuevo dispositivo Nanomist que vaporiza la piel con lactoferrina liposomada en burbujas lipídicas”. La aplicación de nanotecnología en el desarrollo de Lactyferrin Defense es lo marca la diferencia frente al resto de productos con lactoferrina ya existentes en el mercado.
La lactoferrina está presente en el calostro, en las lágrimas e incluso en la saliva, proporcionando una protección global. La proteína, de acción antivírica, antiinflamatoria y antioxidante, tiene un gran poder de estimulación del sistema inmune que activa los mecanismos naturales de defensa.
Más de un centenar de personas, como Margaret Chen, presidenta de China Club Spain, el presidente del Colegio Oficial de Farmacéuticos de Madrid, Luis J. González Díez y la vocal de Dermofarmacia y Productos Sanitarios, Rosalía Gozalo, asistieron a la conferencia que Serrano impartió en Madrid.

Síndrome de Asperger con alto contenido intelectual

Filed under: FUNCIONES PSIQUICAS — Enrique Rubio @ 21:19

SÍNDROME DE ASPERGER Y COCIENTE INTELECTUAL 162 MAYOR QUE EL DE EINSTEIN
Comparte

El síndrome de Asperger es un trastorno del desarrollo que se incluye dentro del espectro autista y que afecta la interacción social reciproca, la comunicación verbal y no verbal, una resistencia para aceptar el cambio, inflexibilidad del pensamiento así como poseer campos de interés estrechos y absorbentes.
El síndrome de Asperger es un trastorno neurobiológico que forma parte de un grupo de afecciones denominadas trastornos del espectro autista. A su vez la expresión «espectro autista» se refiere a un abanico de trastornos del desarrollo que incluyen tanto el autismo como otros trastornos de características similares.
Los síntomas de cada uno de ellos pueden aparecer en diferentes combinaciones y en distintos grados de severidad: dos niños con el mismo diagnóstico, a pesar de tener en común ciertos patrones de comportamiento, pueden presentar una amplia gama de habilidades y de capacidades.
Y cuando se habla de ellos se suelen utilizan expresiones de carácter general, como «autismo con bajo funcionamiento», «autismo con alto funcionamiento», «tendencias autistas» o «trastorno generalizado del desarrollo» para describir a niños cuyos comportamientos que se sitúan dentro de este espectro. Los niños con síndrome de Asperger comparten muchos síntomas con los que padecen un «autismo de alto funcionamiento».
Los niños son tres a cuatro veces más proclives que las niñas a tener síndrome de Asperger. Puesto que en la actualidad se están detectando casos leves con mayor frecuencia que en el pasado, la incidencia de este síndrome parece estar aumentando. De todos modos, como ocurre con lo demás trastornos del espectro autista, se trata de un síndrome difícil de diagnosticar y de tratar.
Por lo tanto es fácil imaginar que estamos ante aquellas entidades que cabalgan entre varios criterios y dificultan el diagnóstico

Hans Asperger, un pediatra vienés que, en 1944, describió por primera vez una serie de patrones de comportamiento que él había observado en algunos de sus pacientes, mayoritariamente de sexo masculino. Asperger observó que aquellos pacientes, a pesar de presentar una inteligencia y un desarrollo del lenguaje normales, tenían graves deficiencias en las habilidades sociales, no sabían comunicarse eficazmente con los demás y presentaban problemas de coordinación.
Según la Coalición para el Síndrome de Asperger de EE.UU., el síndrome de Asperger aparece más tarde que el autismo o, por lo menos, se detecta más tarde. Muchos niños se diagnostican después de haber cumplido 3 años y la mayoría de los afectados se diagnostican cuando tienen entre 5 y 9 años.
El síndrome de Asperger se caracteriza por la presencia de interacciones sociales deficientes o inadecuadas, obsesiones, patrones del habla extraños y otras peculiaridades o rarezas características. Los niños con síndrome de Asperger a menudo muestran poca expresividad facial y tienen dificultades para leer el lenguaje corporal de los demás; pueden implicarse en rutinas obsesivas y presentar una sensibilidad inusual a los estímulos sensoriales (por ejemplo, les puede molestar una luz que a los demás no les afecta, pueden taparse los oídos para no oír los ruidos fuertes del entorno o pueden preferir llevar prendas de ropa de un solo tipo tejido).
Las personas con síndrome de Asperger son capaces de funcionar con adecuadamente en la vida cotidiana, pero tienden a ser inmaduras desde el punto de vista social y la gente las suele ver como personas raras o excéntricas.
Entre otras características del síndrome de Asperger, se incluyen el retraso motor y la torpeza, así como el hecho de presentar intereses limitados y preocupaciones peculiares. Los adultos con síndrome de Asperger tienen problemas para mostrar empatía hacia los demás y siguen presentando dificultades en sus interacciones sociales.
Los expertos afirman que el síndrome de Asperger sigue un curso continuo y normalmente dura toda la vida. La evolución de los síntomas es oscilante a lo largo de su vida
Los síntomas del síndrome de Asperger suelen ser difíciles de distinguir de los que aparecen en otros problemas del comportamiento, lo mejor es que un médico u otro profesional de la salud evalúe los síntomas de su hijo. No es nada raro que a un niño le diagnostiquen primero un trastorno de déficit de atención con hiperactividad (TDAH) antes de diagnósticarle de síndrome de Asperger.
Los niños con síndrome de Asperger pueden presentar los siguientes signos y síntomas:
interacciones sociales mínimas o inadecuadas
conversaciones que siempre tratan sobre sí mismos en vez de los demás
lenguaje «programado», «robótico» o repetitivo
falta de «sentido común»
problemas para leer, escribir y con las matemáticas
obsesiones sobre estímulos complejos, como determinados patrones visuales o determinadas melodías
capacidades cognitivas no verbales entre normales a por debajo de la media, mientras que sus capacidades cognitivas verbales suelen ser entre normales y por encima de la media
movimientos torpes (niños patosos)
comportamientos y gestos peculiares o extraños

A diferencia de los niños con autismo, los que tienen síndrome de Asperger pueden no presentar ningún retraso en el desarrollo del lenguaje y suelen tener buena gramática y un vocabulario desarrollado a edades tempranas. De todos modos, es típico que presenten trastorno del lenguaje, ya que tienden a ser excesivamente literales y tienen problemas en el uso del lenguaje en contextos sociales.
Los niños con síndrome de Asperger no suelen presentar retrasos evidentes en el desarrollo cognitivo. A pesar de que pueden tener problemas para concentrarse y organizarse y presentar capacidades bien desarrollados en algunas áreas y deficitarias en otras, su inteligencia se suele encontrar en la media y a veces o por encima de la media.

Existen serias dudas sobre la etiología del síndrome de Asperger. Muchos creen que el patrón de comportamiento que caracteriza al síndrome de Asperger puede tener muchas causas.

Las anomalías cerebrales se han encontrado en este síndrome, con técnicas de imagen se han detectado diferencias estructurales y funcionales en regiones específicas del cerebro de niños afectados por este síndrome.
También parece haber un componente hereditario en el síndrome de Asperger, y las investigaciones indican que en algunos casos este síndrome se puede asociar a otros trastornos mentales, como la depresión y el trastorno bipolar.
Parece que, el síndrome de Asperger no está provocado por carencias emocionales ni por el tipo de educación recibida. Ya que algunos de los comportamientos que presentan algunas personas con síndrome de Asperger pueden ser vistos por los demás como faltas de educación deliberadas, mucha gente asume erróneamente que el síndrome de Asperger es el resultado de una mala educación por parte de los padres de los afectados, algo que es absolutamente falso. Se trata de un trastorno neurobiológico cuyas causas todavía no se acaban de entender por completo.
En la actualidad no es posible curar este trastorno; los niños con síndrome de Asperger se convierten en adultos con síndrome de Asperger. Pero muchos llevan vidas plenas y felices, y la posibilidad de lograr este objetivo se ve favorecida si la educación, el apoyo y los recursos son los adecuados.

El síndrome de Asperger puede ser muy difícil de diagnosticar. Los niños con esta enfermedad tienen un funcionamiento normal en muchos aspectos de la vida, de modo que es fácil atribuir sus extraños comportamientos simplemente a que son «diferentes».
Los expertos afirman que una intervención precoz, que englobe tanto aspectos educacionales como sociales, llevada a cabo en un momento en que el cerebro todavía está en proceso de desarrollo, es sumamente importante para un niño afectado por este síndrome.
El especialista que vea al niño, tendrá que llevar a cabo una evaluación «psicosocial» completa.
Esto incluirá una entrevista a los padres sobre cuándo se identificaron los síntomas del niño por primera vez, el desarrollo de la motricidad y del lenguaje, así como otros aspectos de la personalidad y del comportamiento del niño (actividades favoritas, hábitos inusuales, preocupaciones, etc.).
Se hará un énfasis especial en el desarrollo social, incluyendo los problemas pasados y actuales del niño en lo relativo a las relaciones sociales y al desarrollo de las amistades. Normalmente se realiza una evaluación psicológica y de las habilidades comunicativas del niño para identificar las áreas donde presenta mayores deficiencias.
La subjetividad de los síntomas hace muy difícil el diagnóstico del síndrome de Asperger De todos modos, en función de cuáles sean sus puntos fuertes y débiles (o de sus antecedentes evolutivos), los niños con síndrome de Asperger se pueden beneficiar de los siguientes tratamientos:
información y entrenamiento para los padres
intervencion educacional especializada para el niño
entrenamiento en habilidades sociales
terapia del lenguaje
entrenamiento en integración sensorial para los niños más pequeños, normalmente llevada a cabo por terapeutas ocupacionales, en la cual los niños se desensibilizan ante los estímulos a los que son excesivamente sensibles
psicoterapia o terapia cognitivo-conductual para los niños mayores
medicación
El hecho de que todas las personas que cuidan de su hijo se involucren en su tratamiento será de gran ayuda para él. Los profesionales de la salud que atienden a su hijo deberían estar informados de lo que hacen los demás y usted a menudo se encontrará actuando como el «director general» de toda la escena. Los profesores, canguros, otros miembros de la familia, los amigos cercanos y cualquier otra persona que cuida de su hijo también deberían involucrarse en el proceso.
Es importante saber que hay muchas personas que pueden proporcionar asistencia a su hijo. La clave está en pedir ayuda lo antes posible y encontrar el programa adecuado para el niño. Los niños con síndrome de Asperger pueden experimentar grandes avances con el tratamiento y la educación adecuados.
Aunque el síndrome de Asperger plantea desafíos tanto a los niños afectados como a sus padres, usted puede ayudar a su hijo en su proceso de adaptación y ofrecerle su apoyo de muchas formas diferentes:
Busque programas educacionales y de formación para padres. Usted es el primer maestro de su hijo y seguirá siendo una figura clave fundamental para favorecer su desarrollo.
Enseñe a su hijo las habilidades necesarias para cuidar de sí mismo. Aprender estas habilidades ayuda a los niños a desarrollar la máxima independencia.
Puesto que no siempre es fácil reconocer la presencia de el síndrome de Asperger, avise a los demás de que su hijo tiene necesidades especiales. En calidad de padre, es posible que deba asumir el papel de educador cuando trate con los profesores, el personal médico y otros cuidadores de su hijo.
Busque un programa orientado a tratar las necesidades específicas de su hijo o las áreas donde presenta mayores deficiencias. La Sociedad Americana del Autismo (ASA, por sus siglas en inglés) anima a los familiares a que hablen con el director del programa para determinar si su currículum atiende las cuestiones específicas de su hijo.
Elija programas y tratamientos especiales que se centren en los resultados a largo plazo y que tengan en cuenta los niveles evolutivos de los niños.
Recuerde que su hijo forma parte de la unidad familiar y que sus necesidades se deben sopesar con las de los demás miembros de la familia.
Busque apoyo para usted y para los otros miembros de su familia. Usted no podrá ayudar a su hijo si no atiende sus propias necesidades emocionales y corporales. Es posible que se organicen grupos de apoyo en hospitales o centros de salud mental de su localidad. De todos modos, en EE.UU., existe una gran variabilidad entre los diferentes estados en lo relativo a los tipos de servicios que ofrecen el gobierno y otros programas para niños con trastornos del espectro autista y sus familias.
Algunos de estos niños asisten a escuelas ordinarias donde sus progresos dependen en gran medida del apoyo y del estímulo de sus padres, cuidadores, profesores y compañeros de clase. De todos modos, hay otros que asisten a escuelas especiales para niños con autismo o con trastornos del aprendizaje.
Mucha gente con síndrome de Asperger puede funcionar bien en la mayoría de los aspectos de la vida, de modo que esta afección no tiene que impedir que su hijo se pueda desenvolver bien en el mundo académico y social.
Es posible que, si a su hijo le diagnostican síndrome de Asperger, usted se sienta abrumado y profundamente desalentado. De todos modos, recuerde que el equipo de tratamiento de su hijo les podrá ofrecer un gran apoyo y aliento, tanto a su hijo como a su familia.
Revisado por: Rhonda S. Walter, MD
Fecha de revisión: enero de 2012
Transcribo ahora un caso de síndrome de Asperger que en la actualidad, estudia dos carreras universitarias e inglés para cumplir su sueño: ser astronauta
Adhara Pérez es una niña muy especial. Su madre, Nallely Sánchez, dice que es una excelente persona, que es muy humana. Sin embargo, durante sus primeros años en la escuela sus compañeros la llamaban rara porque se dormía en clase, porque no tenía capacidad de hacerse fácilmente amigos o porque se pasaba el día hablando del espacio, su pasión.
Sufrió bullying e incomprensión. Después vino la depresión y la lucha de su madre por ayudar a su hija a salir adelante. Un diagnóstico les arrojó luz: “Síndrome de Asperger” (el mismo que tiene Greta Thunberg). Nallely entiende ahora porqué su hija no capta el doble sentido o le cuesta socializarse.

Adhara comenzó a continuación una terapia que proporcionó todavía más luz sobre sus talentos. Fue precisamente en el Centro de Atención al Talento de Ciudad de México donde le hicieron unos tests de inteligencia que desvelaron un coeficiente intelectual de 162 puntos, dos más que los de Albert Einstein y Stephen Hawking.
Este conocimiento ayudó mucho a la familia de Adhara. Su niña “rara” es una de personas más inteligentes del planeta y, como explica su madre, quiere darle todo su apoyo, pese a las dificultades que pueda conllevar educar a una hija con Altas capacidades.

Qué hacer con un hijo con altas capacidades?
De momento, el camino que han decidido seguir para que su hija sea feliz es el de animarle desarrollar su inteligencia para cumplir su sueño. Adhara aspira llegar muy alto, quiere ser astronauta.
Por eso, a los 6 años terminó la Primaria y a los 8 el Bachillerato. Ahora se divierte con las derivadas mientras estudia dos ingenierías: Ingeniería Industrial en Matemáticas en UNITEC e Ingeniería en Sistemas por CNCI.
Mientras tanto, su familia vela para que su hija sea feliz después de haber cambiado, gracias a dos importantes diagnósticos, el recorrido educativo de Adhara en un momento en el que su madre le dijo: “Si no te gusta dónde estás, imáginate dónde quieres estar”.
Y claro, una mente maravillosa como la Adhara no podría imaginarse algo sencillo, como ser profesora o periodista. Ella quiere estudiar Astrofísica en la Universidad de Arizona y trabajar para la NASA. Lógico si pensamos como alguien que sabe analizar sistemas complejos y cuestiones complejas como los agujeros negros o los agujeros de gusano.

Estamos viendo patología de la tercera dimensión, no se trata ya núcleos y circuitos. Entrada de proyección mental, donde coexisten trastornos del adaptación social y coeficientes del superdotado.
Cuesta mucho trabajo localizar la función psíquica, pero la coexistencia de elevada funciones psíquicas e intelectuales y al mismo tiempo inadaptación social, que es casi imposible admitir.
No, nos queda más remedio que seguir. Seguro que el cerebro está evolucionando, y qué nos queda mucho por ver. Pero ahí estamos, esperar y ver.

21 febrero 2020

El sistema nervioso simpático en el síncope vasovagal

Filed under: General,vasculo cerebral,Vegetativo — Enrique Rubio @ 21:34

Papel del sistema nervioso simpático en el síncope vasovagal y justificación del uso de betabloqueadores e inhibidores del transportador de noradrenalina
Manlio F. Márquez , Jorge Rafael Gómez-Flores , Jesús A. González-Hermosillo, Teresita de Jesús Ruíz-Siller, Manuel Cárdenas

Introducción
. El síncope vasovagal es un tipo de intolerancia ortostática. Este término se usa para referirse al síncope que resulta de mecanismos reflejos asociados con vasodilatación inapropiada y grados variables de bradicardia. También es conocido como síncope reflejo, síncope neurocardiogénico o síncope neuralmente mediado.
Síncope vasovagal
El síncope se define como una pérdida de consciencia y del tono postural repentina y temporal, como resultado de una disminución transitoria en la perfusión cerebral global, con instauración repentina, corta duración y recuperación completa [2]. El síncope es un problema clínicamente significativo, responsable del 1% de las admisiones hospitalarias y 3% de las visitas a las salas de urgencias, con una morbilidad y mortalidad superior al 7% [3],[4]. El síncope es una manifestación de diferentes procesos y por lo tanto debe ser visto como un síntoma y no una enfermedad, y debe ser clasificado de acuerdo a la causa de base. Siempre es importante, especialmente en pacientes ancianos, descartar otras causas de síncope, tales como enfermedad carotidea oclusiva, hipersensibilidad del seno carotideo o hipotensión ortostática neural (neuropatía autonómica) [5]. Casi el 40% de la población general sufre de al menos un episodio de síncope a lo largo de su vida [6]. El síncope vasovagal es el tipo más común de síncope. La incidencia pico se da en la adolescencia. La mayoría de los pacientes con síncope vasovagal son mujeres jóvenes entre 15 y 45 años de edad. El síncope vasovagal puede ser resultado de algún tipo de estrés emocional (el cual se comporta como gatillo) o cambio de postura, tal como el adoptar de forma repentina la posición de pie. El síncope vasovagal generalmente va precedido por sensación de mareo, debilidad, náusea, diaforesis o problemas visuales. Es interesante remarcar que el síncope vasovagal, síndrome de taquicardia postural ortostática, el síndrome de fatiga crónica y la fibromialgia tienen una causa de base en común: una disfunción del sistema nervioso autónomo, y por lo tanto se agrupan en un término: “Disautonomías” [7],[8]. El sistema nervioso autónomo regula funciones fisiológicas que no dependen de la consciencia (digestión, frecuencia cardiaca, presión arterial, etcétera). Consiste en dos subsistemas: el simpático y el parasimpático (o vagal). El primero es un estimulante de funciones neurovegetativas mientras que el segundo las deprime. Son tradicionalmente vistos como sistemas antagonistas y normalmente están en equilibrio: si uno está activo el otro es inhibido para compensar. Cuando se pierde este balance, pueden aparecer diversos síntomas incluyendo disnea, taquicardia, fatiga, parestesia, mareo, dolor muscular, síndrome de intestino irritable, dolor torácico, ansiedad, depresión y/o síncope. La manifestación del síncope y la presencia de manifestaciones clínicas de intolerancia ortostática (fatiga, mareo, etcétera) son de gran importancia y magnitud puesto que pueden conducir a una incapacidad [9]; por lo tanto, cualquier intento para disminuirlos o evitarlos debe ser tomado en consideración.
Antecedentes históricos
La primera mención de vagotonía como una entidad clínica corresponde a los doctores Eppinger y Hess, quienes publicaron en libro titulado “Die Vagotonie” [10] en 1910. En su libro mencionan que la bradicardia sinusal podía ser controlada, aunque de forma temporal, mediante la administración de una sustancia vagolítica tal como atropina. Más tarde, muchos investigadores continuaron los esfuerzos para definir vagotonía en una forma más precisa. Para una excelente reseña histórica sobre este tema, incluyendo un análisis exhaustivo de la tesis del Profesor Salvador Zubirán («Vagotonía», publicada en la Ciudad de México en 1923) referimos al lector al artículo escrito por los doctores Delgado y Estañol [11].
El término “síncope vasovagal” fue introducido por Sir Thomas Lewis [12] pero Da Costa había observado previamente manifestaciones clínicas similares en soldados que pelearon durante la guerra civil en los Estados Unidos de América [13] y lo llamó «corazón irritable». Desde entonces, a los síntomas sin explicación médica que surgían en los soldados en tiempos de guerra se les ha otorgado diversos términos genéricos, y aún tan reciente como en 1990 se les agrupó dentro del término “síndromes de guerra” o “desórdenes post-combate”. Para una revisión completa referimos al lector al trabajo de Jones [14]. En breve, durante la Primera Guerra Mundial, doctores británicos encontraron manifestaciones clínicas similares en los soldados y lo llamaron “acción desorganizada del corazón”; Lewis lo llamó “corazón del soldado” o “síndrome de esfuerzo” y Levine le dio un nombre más científico: “astenia neurocirculatoria” [15]. El Profesor Ignacio Chávez, en 1933, en su libro “Cinco lecciones de cardiología clínica” reportó, tras haber estudiado un paciente con síncope: “dado que se queja de dolor en muchos sitios anatómicos al mismo tiempo y con gran intensidad, es muy probable que no tenga lesiones en ninguno de ellos, y que la enfermedad provenga del sistema neurovegetativo” [16]. Durante la Segunda Guerra Mundial, se notó nuevamente que en respuesta al estrés durante el combate aparecían síntomas somáticos en los soldados, incluyendo fatiga, palpitaciones, cefalea, diarrea, dificultad para concentrarse y alteraciones del sueño. Inicialmente conocido como “neurosis de guerra”, el uso de dicho término se rechazó más tarde puesto que implicaba que los soldados estaban enfermos, lo cual ejercía presión en los militares para tomar responsabilidad de ellos como pacientes [12]. En 1941 Wood [17] lo atribuyó a una forma de psiconeurosis, y en la tercera edición (1968) de su libro lo incluyó dentro de las manifestaciones cardiovasculares de psicopatías. La interrelación de los aspectos psicológicos y el síncope vasovagal está hoy en día bien documentada [18],[19]. Los hallazgos más recientes relacionados a trastornos post-combate son aquellos de la Guerra del Golfo (1990-1991). Algunos reportes confirman que puede existir disfunción del sistema nervioso autónomo en veteranos de la Guerra del Golfo con fatiga crónica [20],[21],[22].
Fisiopatología del síncope vasovagal
Tono autonómico basal en el síncope vasovagal
Existen resultados controversiales respecto a parámetros basales del tono autonómico entre pacientes con síncope y los controles (individuos sanos). La Tabla 1 [23],[24],[25],[26],[27] muestra una lista de estudios que incluyen dominios de tiempo y frecuencia, variabilidad de frecuencia cardiaca y microneurografía. La mayoría han fallado en demostrar una diferencia en los valores medios de los índices de variabilidad de frecuencia cardiaca entre sujetos normales y pacientes con síncope vasovagal. Solamente Shim et al [27] encontraron evidencia de un incremento en el tono vagal basal en niños con síncope vasovagal. Una observación interesante fue reportada por Guzmán y colaboradores [24]: encontraron una disminución en la media de la desviación de la raíz cuadrada de los intervalos R-R (RMSD) y un ratio más alto de baja frecuencia/alta frecuencia (BF/AF ratio) en sujetos con una prueba de inclinación positiva (HUT) con una respuesta vasodepresora en comparación con aquellos con una respuesta cardioinhibitoria o mixta. Este hallazgo podría implicar un tono simpático incrementado en el grupo vasodepresor aunque otros investigadores no lo han reproducido.
Recientemente, Efremov y colaboradores [26] reportaron que el análisis de la variabilidad de frecuencia cardiaca dentro de los primeros 20 minutos pasivos en la prueba de inclinación demostraron que los pacientes con síncope inducido por nitroglicerina se caracterizan por presentar una disminución de la actividad parasimpática, lo cual no ocurre en pacientes con una respuesta negativa a la nitroglicerina. En pacientes que tuvieron una prueba de inclinación positiva, dos parámetros espectrales de la variabilidad de frecuencia cardiaca: frecuencia cardiaca y poder total tuvieron una disminución significativa de la fase pasiva a la fase con utilización de nitroglicerina, mientras que en los sujetos negativos la frecuencia cardiaca promedio y los valores de poder total no cambiaron. Estamos completamente de acuerdo con Efremov y colaboradores en que “se necesita más investigación para evaluar si un análisis apropiado de la variabilidad de frecuencia cardiaca puede mejorar la diferenciación entre diferentes tipos de síncope”.

Tabla 1. Estudios sobre tono basal autónomo en syncope vasovagal.

Respuesta neurohumoral a la posición de pie
En los humanos, el mantener un suministro adecuado de sangre a los órganos vitales al estar de pie desafiando la gravedad constituye un reto fisiológico importante. El estar de pie debería ser considerado un esfuerzo para nuestras capacidades reguladoras de la circulación; se requiere que la estructura y el buen funcionamiento del corazón, los vasos sanguíneos, y el sistema nervioso autónomo estén intactos. También es relevante un volumen sanguíneo adecuado y la habilidad de los músculos esqueléticos de las piernas para comprimir las venas y facilitar el regreso de la sangre al corazón. El cambio de la posición decúbito a ortostática resulta en la acumulación de 300 a 800 ml de sangre en las extremidades inferiores y la circulación esplácnica, causando hipovolemia central, debido a una disminución en el retorno venoso al corazón con reducción concomitante del llenado ventricular izquierdo (precarga), con caída transitoria del volumen de salida del ventrículo izquierdo y la presión arterial. Para un mejor entendimiento del reflejo barorreceptor, referimos al lector a un excelente artículo en español publicado por Estañol y colaboradores [28] en 2011. En resumen, la actividad del sistema nervioso simpático es regulada en primer lugar por mecanorreceptores (barorreceptores), los cuales detectan cambios en la presión arterial, y en un grado menor por quimiorreceptores. Los barorreceptores arteriales (receptores de alta presión) están localizados en el seno carotideo y arco aórtico, y los barorreceptores cardiopulmonares (receptores de baja presión) en las grandes venas, aurículas (receptores A y B, reflejo de Bainbridge [un incremento en la presión o una distención aumentada de la aurícula derecho causa aceleración del latido cardiaco, también llamado “efecto Bainbridge”]), y ventrículos (reflejo Bezold-Jarisch). En estos mecanorreceptores, los canales iónicos son activados por estiramiento y modulan la actividad eferente simpática mandando información aferente al núcleo del tracto solitario (tractus solitarius) [29].
Los barorreceptores responden a la disminución en el retorno venoso y presión arterial que ocurre al momento de tomar la posición de pie con un incremento en la actividad simpática eferente y una disminución en el tono p arasimpático, lo cual resulta en un incremento de la frecuencia cardiaca e inotropismo, así como vasoconstricción arterial periférica. Por lo tanto, la hipovolemia central trnasitoria con una caída transitoria concomitante del volumen de salida del ventrículo izquierdo resulta en una distención más baja de los barorreceptores del seno carotídeo y el arco aórtico, con una reducción de la actividad barorrefleja aferente al tronco cerebral, con una consecuente activación simpática eferente e inhibición parasimpática que finalmente incrementa la frecuencia cardiaca y la resistencia vascular periférica, en un intento, por lo general exitoso, de restaurar el volumen de salida cardiaco y la presión arterial. Para ayudar a minimizar la reducción en la presión arterial ortostática, se ha descrito un incremento en la reabsorción de fluidos asociada con un incremento en resistencias periféricas totales [30],[31]. Tras una recuperación de la caída inicial de la presión arterial durante el ortostatismo, el volumen sanguíneo disminuye lentamente debido a la filtración microvascular.
En condiciones normales, el estrés ortostático evoca vasoconstricción compensatoria en múltiples lechos vasculares incluyendo los músculos esqueléticos. La actividad de los nervios simpáticos de los músculos se podría registrar en los humanos por microneurografía; se trata de una evaluación directa de la actividad nerviosa simpática en individuos conscientes [32] y está estrechamente ligada a la presión arterial vía el mecanismo barorreflejo de cada persona. En respuesta a una inclinación progresiva, en individuos sanos esta actividad simpática incrementa y se correlaciona con el grado de inclinación [33].
Jacob y colaboradores [34], estudiaron los cambios neurohumorales en respuesta al ortostatismo en individuos saludables y notaron un rápido y progresivo incremento en la descarga de noradrenalina, resultando en un incremento en la actividad de los nervios simpáticos y una disminución en la noradrenalina sérica [35]. La correlación estrecha entre la frecuencia cardiaca y la concentración de adrenalina plasmática descrita por Jacob [34] sugiere que esto puede provocar el incremento en la frecuencia cardiaca durante los primeros minutos del reto ortostático. El incremento en las concentraciones plasmáticas de noradrenalina estimula los receptores alfa-1 adrenérgicos e induce vasoconstricción. Estos autores también mostraron elevación sostenida de la aldosterona e incremento en la actividad del sistema renina-angiotensina-aldosterona. Estas respuestas estuvieron correlacionadas con la hipovolemia transitoria asociada con el desplazamiento del fluido intravascular a las venas de distintos compartimentos incluyendo abdomen, región pélvica y extremidades. El incremento en la actividad de renina y aldosterona ejerce múltiples efectos compensatorios para mantener la postura: incremento en la reabsorción tubular renal de sodio, vasoconstricción directa y facilitamiento de la descarga de noradrenalina actuando en neuronas noradrenérgicas presinápticas, y posiblemente en el sistema nervioso central.
Respuesta simpática al reto ortostático en la prueba de inclinación y su supresión previa al síncope vasovagal
Dada la importancia del sistema nervioso simpático en regular la respuesta a los cambios posturales, se ha considerado que diversos grados de disfunción simpática están involucrados en la intolerancia ortostática. Los primeros estudios en investigar la fisiopatología del síncope vasovagal mostraron que un reflejo paradójico y compensatorio estaba involucrado. La llamada “teoría ventricular” postula que los barorreceptores reaccionan a la disminución en la presión arterial con una activación del sistema nervioso simpático, causando una mayor respuesta inotrópica y cronotrópica, así como vasoconstricción periférica [36]. Esta teoría sugiere que las contracciones vigorosas de un ventrículo izquierdo depletado en volumen causa activación debido al estiramiento de las fibras C del corazón (mecanorreceptores formados por fibras desmienilizadas encontrados en aurículas, ventrículos y arteria pulmonar). Esta estimulación de fibras C aferentes produce una supresión “paradójica” del tono simpático periférico y un incremento en el tono vagal, causando vasodilatación y bradicardia [37]. Observaciones más recientes refutaron esta teoría. Novak y colaboradores [38] usando mediciones ecocardiográficas del ventrículo izquierdo y la fracción de expulsión no encontraron evidencia de un vaciamiento cardiaco progresivo previo al síncope; y Liu y colaboradores [39], usando medidas del esfuerzo y engrosamiento de la pared segmental del ventrículo izquierdo, no encontraron evidencia de la activación de mecanorreceptores en esta cámara.
La interrupción abrupta de la actividad nerviosa simpática de la vasculatura de los músculos esqueléticos, representando una “caída” simpática, ha sido considerado un paso importante para la vasodilatación que lleva a la hipotensión. Estudios previos mostraron que previo al síncope vasovagal, la actividad simpática eferente medida con microneurografía, disminuía progresivamente o era interrumpida de forma abrupta [40]. Esta reducción en la actividad simpática estuvo directamente relacionada con la presión arterial media, mientras que la actividad parasimpática medida por análisis espectral de la variabilidad de la frecuencia cardiaca permaneció por debajo de lo basal, sugiriendo que el control simpático de la resistencia periférica total fue el mecanismo responsable del síncope vasovagal. Morillo y colaboradores [23] demostraron que durante ≈100 segundos antes del establecimiento del presíncope, las presiones sistólica y diastólica y la actividad simpática de los nervios musculares tendía a bajar (p=0,015, 0,054 y 0,19). Cuando se estableció el presíncope, la microneurogafía promedio y la presión arterial bajaron de forma abrupta. Este estudio estableción el concepto de “retiro simpático” como el principal mecanismo que precede al síncope vasovagal. Mosqueda-Garcia y colaboradores [33] encontraron que el incremento inicial en la actividad simpática (medido por la microneurografía) en respuesta a los cambios en el volumen circulatorio en el ortostatismo, fue diferente entre los pacientes con síncope vasovagal y los controles: estuvo reducida en el primer grupo. Estos pacientes también mostraron una reducción en el incremento máximo en la microneurografía y noradrenalina plasmática que fueron inadecuados para compensar el descenso significativo en la presión arterial. Esta respuesta fue seguida por la inactividad nerviosa y la aparición del síncope. Estos autores también observaron reducciones significativas en las respuestas barorreflejas en pacientes que estuvieron en decúbito; ellos postularon por lo tanto que una disminución en la respuesta barorrefleja podría explicar la incapacidad de estos pacientes para incrementar actividad simpática eferente en respuesta a una caída en la presión arterial. Estos resultados coinciden con los presentados por Bechir y colaboradores [41], quienes también encontraron que pacientes con síncope vasovagal también presentaron una respuesta barorrefleja disminuida durante el reto ortostático y la microneurografía. De forma interesante, estos pacientes tuvieron un tono simpático incrementado en condiciones basales. Este incremento en la modulación del tono simpático vasomotor basal podría depletar su reserva y prevenir el incremento del tono simpático vasomotor eferente para apoyar a las resistencias periféricas durante el estrés ortostático. Sin embargo, observaciones hechas por Vaddadi y colaboradores [42], desacreditan la idea de que el “gatillo” final responsable para una reacción vasovagal ortostática es la inhibición del sistema nervioso simpático, mostrando que la actividad simpática eferente (medida por microneurografía) permaneció normal en nueve de diez pacientes. En estas circunstancias, una hipótesis alterna podría ser que la reducción en la fracción de expulsión es el evento fisiológico predominante que causa la hipotensión. En un estudio reciente conducido en 56 pacientes con sospecha de síncope vasovagal, bajo una prueba de inclinación, se observó una reducción del 50% en la fracción de expulsión, mientras que las resistencias vasculares sistémicas permanecieron estables hasta que se presentó el presíncope [43].
Desórdenes funcionales de las proteínas de los nervios simpáticos
Vaddadi y colaboradores [44] compararon dos grupos de pacientes con síncope vasovagal: aquellos con presión arterial normal en decúbito (sistólica>100 mmHg) con aquellos con presión arterial baja en decúbito (sistólica≤ 100 mmHg). Ambos tipos de pacientes tuvieron un amortiguamiento importante de las concentraciones de noradrenalina plasmática (“rebosamiento” o “derrame” de noradrenalina) en respuesta a la prueba de inclinación, indicando una falla en el sistema nervioso simpático para responder al reto ortostático. Para explicar estos resultados, analizaron las proteínas involucradas en la transmisión neural simpática (síntesis, reserva, salida y recaptación de noradrenalina). Pacientes con síncope vasovagal del grupo 1, que estuvieron “normotensos” en el decúbito, mostraron una reducción en la expresión de tirosin hidroxilasa. Esta enzima es responsable de la producción de noradrenalina, así que un nivel bajo de la misma podría explicar la disminución en la concentración de este neurotransmisor. En contraste, pacientes del grupo 2 (hipotensos en decúbito) mostraron concentraciones elevadas del transportador de noradrenalina. Ese último es responsable del aclaramiento de noradrenalina en la hendidura sináptica para terminar la señal nerviosa. Una expresión aumentada del transportador de noradrenalina podría depurar noradrenalina de una forma más rápida, reduciendo la vasoconstricción compensatoria y predisponiendo a hipotensión postural. Más tarde discutiremos los potenciales usos terapéuticos de este hallazgo.
Inervación miocárdica adrenérgica
Kochiadakis y colaboradores [25] mostraron que pacientes con síncope vasovagal tuvieron un alto grado de disturbio en la inervación miocárdica adrenérgica y múltiples defectos en la inervación adrenérgica. El análisis semi-cuantitativo de la inervación adrenérgica mostró un ratio C/M (corazón/mediastino) significativamente más bajo en pacientes sincopales comparado con el grupo control. Por lo contrario, la tasa de aclaramieinto de 123I-MIBG fue significativamente mayor en pacientes con síncope vasovagal. Ellos sugieren un posible predominio de la actividad adrenérgica cardiaca en aquellos con gammagrafía cardiaca anormal MIBG. El decremento en la toma de MIBG pudiera ser una consecuencia indirecta de ya sea noradrenalina circulante crónicamente incrementada o un incremento en la descarga de noradrenalina miocárdica. La tasa de aclaramiento incrementada pudiera también reflejar un aumento en la actividad nerviosa simpática cardiaca.
Genética del sistema nervioso simpático en el síncope vasovagal
Ha sido bien demostrado que pacientes con síncope vasovagal frecuentemente tienen un familiar de primer grado también afectado [45]. Aunque la participación de la genética en el síncope vasovagal ha sido discutida, alguna evidencia sugiere que hay un componente genético mayor: los receptores adrenérgicos. Los estudios muestran una asociación entre prueba de inclinación positiva en pacientes con síncope y la presencia de polimorfismos de dos receptores adrenérgicos, el Arg389Gly de beta-1 [46] y el Arg347Cys del alfa-1a (α1a) [47]. Desgraciadamente, estos hallazgos no se han reproducido.
Betabloqueadores en síncope vasovagal
Basado en la información previamente presentada, no es sorpresa que los betabloqueadores fueran empleados en el tratamiento del síncope vasovagal desde el inicio [48]. Aunque los resultados iniciales en el uso de betabloqueadores en estudios clínicos no controlados o al ser comparados con tratamiento estándar parecieran prometedores, hay varios estudios controlados, comparados con placebo, en los cuales no se ha demostrado un efecto real de estos fármacos (Tabla 2). Sin embargo, es importante describir algunas de las limitaciones de estos estudios. En primer lugar, debe ser considerado que todos los estudios publicados tienen una muestra pequeña; algunos de ellos incluyeron menos de 10 pacientes. También es importante mencionar que el seguimiento fue corto (Tabla 2) en la mayoría de ellos. El único estudio aleatorizado con un tamaño de muestra adecuado fue síndrome de taquicardia postural ortostática [49] y no pudo demostrar ningún beneficio con el uso de betabloqueadores. Sin embargo, debe ser notado que se utilice una dosis fija de metoprolol en todos los pacientes, sin individualizar la dosis, lo que probablemente justifica la ausencia de resultados positivos. Una dosis fija de metoprolol puede afectar los resultados ya que no todos los pacientes lo toleran. En nuestra práctica clínica hemos aprendido que, dependiendo del individuo, algunas veces es necesario empezar con una dosis muy baja de metoprolol (25-50 mg/día) e incrementarla progresivamente cada 2-4 semanas. En el estudio mencionado (Prevention of Syncope Trial, POST), los investigadores incrementaron la dosis de 50 mg a 100 mg dos veces al día en 3-5 días. Esto pudiera explicar la alta incidencia de abandono del estudio en el grupo que tomó metoprolol (22%). Sin embargo, un subanálisis del estudio mostró que el metoprolol fue efectivo en pacientes mayores de 42 años [50]. Apoyando este descubrimiento, Benditt y colaboradores [51] reportaron que en estos pacientes las diferencias relacionadas con la edad estuvieron relacionadas con la cantidad de catecolaminas circulantes. Ellos encontraron que aunque las concentraciones basales de adrenalina y noradrenalina fueron similares en sujetos jóvenes y en aquellos mayores de 40 años, el ratio de adrenalina y noradrenalina incrementó mucho en pacientes jóvenes. Basado en estos descubrimientos, actualmente está en curso un estudio placebo-controlado sobre el uso de metoprolol en sujetos con síncope vasovagal mayores de 40 años [52]. En una revisión, Raj y Coffin [53], propusieron que los betabloqueadores pueden ser una opción terapéutica razonable para pacientes con síncope vasovagal e hipertensión arterial sistémica.

Tabla 2. Resumen de estudios de betabloqueadores (BB) en el sincope vasovagal.*

Vyas y colaboradores [54] publicaron un metanálisis de todos los estudios sobre diferentes opciones de tratamiento en el síncope vasovagal. Se incluyeron trece estudios en el análisis de pacientes tratados con betabloqueadores. En este metanálisis hubo diferencias significativas a favor de los betabloqueadores cuando se lanzaron los 13 estudios. Una revisión sistemática de la literatura mostró que el tratamiento con betabloqueadores fue significativamente mejor en comparación con la terapia estándar. Sin embargo, no se encontraron diferencias en todos los estudios al compararlos con placebo, otros fármacos o marcapasos [55].
Propiedades farmacológicas de los betabloqueadores y su efecto en el síncope vasovagal
Algunos aspectos que no pueden ser cubiertos por el metanálisis y revisiones sistemáticas con las diferentes propiedades farmacológicas de los betabloqueadores. El factor más relevante en sujetos con síncope vasovagal es la actividad simpática intrínseca, lo cual limita el efecto de bradicardia de algunos betabloqueadores tal como el pindolol. Aunque este efecto puede ser útil para evitar más bradicardia en sujetos con tendencia a frecuencia cardiaca baja, también puede estar asociado con palpitaciones, lo cual puede limitar su uso. A este respecto, la titulación de la dosis es un factor muy importante que no se ha tomado en cuenta en estudios previos. También es importante para la especificidad a los órganos objetivo de los betabloqueadores. Las diferencias entre antagonistas no selectivos (con o sin actividad alfa antagonista) en comparación con el selectivo beta-antagonista-1 tampoco han sido abordados de forma adecuada. El uso de agentes con actividad vasodilatadora arteriolar (ej. labetalol, carvedilol, nebivolol) puede ser más util en el subgrupo de pacientes que también sufren de hipertensión reactiva, pero podría dañar a pacientes propensos a presión arterial baja. Finalmente, la afinidad de algunso betabloqueadores, tal como pindolol, para el subtipo de receptors de serotonina 1A (5-HT1A) para depresión pudiera también ser parte del efecto en el síncope vasovagal [56].
Inhibidores de la recaptación de noradrenalina en síncope vasovagal
Como se mencionó, la recaptación de noradrenalina en la hendidura sináptica, hecha posible por el transportador de noradrenalina, es el mecanismo principal de inactivación de esta catecolamina. Por lo tanto, la acción del transportador de noradrenalina es un factor clave en su regulación. Concentraciones aumentadas del transportador de noradrenalina o un incremento en su función resultarían en una inactivación mayor de noradrenalina y viceversa (una disminución en su concentración o menor actividad del transportador de noradrenalina implicaría mayor acción de los receptores adrenérgicos). En un caso con síndrome de taquicardia postural ortostática, Goldstein y colaboradores [57] encontraron una mutación que disminuyó la función del transportador de noradrenalina en 98%, demostrando por primera vez una relación entre una función disminuida de este transportador con hiperactividad simpática clínica, manifestada por taquicardia postural.
Por otro lado, una actividad incrementada del transportador de noradrenalina, aclarando más rápidamente el neurotransmisor, reduciría la vasoconstricción compensadora predisponiendo a hipotensión ortostática. Esta posibilidad teórica es apoyada por diversos estudios. Schroeder y colaboradores [58] mostraron una mejor tolerancia a la prueba de inclinación bajo tratamiento con inhibidor del transportador de noradrenalina (reboxetina) comparada con placebo en 18 sujetos sanos. La reboxetina es un fármaco que es usado como antidepresivo. Bajo placebo, ocurrió una reacción vagal en el 50% de los individuos (9 de 18), mientras que sólo un individuo sufrió desmayo (5%) bajo reboxetina. Expandieron su observación con 51 sujetos sanos sin historia de síncope [59]. En este grupo, compararon dos inhibidores del transportador de noradrenalina: sibutramina (un fármaco usado para pérdida de peso) o reboxetina. Mostraron nuevamente una mayor tolerancia al ortostatismo pasivo durante la prueba de inclinación; la duración de la prueba antes de que el paciente presentara reacción vagal incrementó de 29 ± 2 a 35 ± 1 min (p = 0,001) cuando el sujeto estaba bajo el efecto de cualquiera de estos dos inhibidores. Una excelente revisión de estos hallazgos y sus implicaciones fue expuesto por el principal autor de estos trabajos en el 2012 [60]. Sheldon y colaboradores [61] reportaron que cinco de siete pacientes muy sintomáticos con múltiple recurrencia de síncope vasovagal (32 eventos en promedio por mes) tratados con sibutramina mostraron una reducción en la frecuencia de desmayos por más del 50%.
Se retiró la sibutramina del mercado en muchos países, incluyendo México, al mostrar un estudio incremento en la tasa de eventos cardiovasculares (infarto agudo al miocardio y evento vascular cerebral) en personas con enfermedad cardiaca previa. Ramírez y colaboradores [62] reportaron que la atomoxetina, un inhibidor del transportador de noradrenalina aprobado para el tratamiento del déficit de atención, podía incrementar la presión arterial en individuos con falla autonómica. La atomoxetina fue aún mejor que la midodrina en mejorar la presión arterial al adoptar la posición ortostática en un grupo de 65 pacientes con falla autonómica severa (causado por enfermedad de Parkinson, atrofia múltiple sistémica o falla autonómica pura). Por lo tanto, la atomoxetina podría ser una opción terapéutica para síncope vasovagal dada su disponibilidad en muchos países en la posibilidad de utilizar dosis pediátricas.
Conclusiones
Al momento, los betabloqueadores son considerados un placebo porque no hay evidencia fuerte sobre su uso. Sin embargo, se necesitan con urgencia más estudios sobre el uso de betabloqueadores en síncope vasovagal basados en la información presentada en este documento y en el hecho de que aún son usados en la práctica clínica dada la excelente respuesta reportada por expertos clínicos. Un estudio multicéntrico (POST-5) se está llevando a cabo en un intento de probar esta hipótesis. Estudios recientes en la inhibición de la recaptación de noradrenalina con agentes específicos han mostrado resultados prometedores en esta entidad y ameritan más investigación.
Referencias
Hermosillo AG, Márquez MF, Jáuregui-Renaud K, Cárdenas M. Orthostatic hypotension, 2001. Cardiol Rev. 2001 Nov-Dec;9(6):339-47. | PubMed |
Medow MS, Stewart JM, Sanyal S, Mumtaz A, Sica D, Frishman WH. Pathophysiology, diagnosis, and treatment of orthostatic hypotension and vasovagal syncope. Cardiol Rev. 2008 Jan-Feb;16(1):4-20. | PubMed |
Mathias CJ, Deguchi K, Schatz I. Observations on recurrent syncope and presyncope in 641 patients. Lancet. 2001 Feb 3;357(9253):348-53. | PubMed |
Celaya Cota M de J, Márquez MF. Evaluación de síncope en el Servicio de Urgencias. In: Manual de Urgencias Cardiovasculares. Cuarta. México: Mc Graw Hill;2012.
Allende R, Cázares Campos I, Márquez MF. Neuropatía. En: Atención Integral Del Paciente Diabético. Cuarta. México: Mc Graw Hill; 2011.
Cárdenas M, Vallejo M, Martínez-Palomino G, Paredes-Balderas G, Sandoval-Rubio LA, et al. Prevalencia de síncope en una muestra de mujeres mexicanas residentes en la ciudad de México. Arch Cardiol México. 79(3):197-200. | Link |
Martínez-Martínez LA, Mora T, Vargas A, Fuentes-Iniestra M, Martínez-Lavín M. Sympathetic nervous system dysfunction in fibromyalgia, chronic fatigue syndrome, irritable bowel syndrome, and interstitial cystitis: a review of case-control studies. J Clin Rheumatol. 2014 Apr;20(3):146-50. | CrossRef | PubMed |
Lerma C, Martinez-Martinez LA, Ruiz N, Vargas A, Infante O, Martinez-Lavin M. Fibromyalgia beyond reductionism. Heart rhythm fractal analysis to assess autonomic nervous system resilience. Scand J Rheumatol. 2016;45(2):151-7. | CrossRef | PubMed |
Lobban TC. Syncope: a patient and family perspective. Cardiol Clin. 2013 Feb;31(1):1-8. | CrossRef | PubMed |
Eppinger H, Hess L. Die Vagotonie. Berlin: Eine Klinische Studie; 1910.
Delgado G, Estañol-Vidal B. Vagotonía. La tesis recepcional de Salvador Zubirán. Rev Invest Clin. 2012;64(4):387-398. | Link |
Lewis T. A Lecture on vasovagal syncope and the carotid sinus mechanism. Br Med J. 1932 May 14;1(3723):873-6. | PubMed |
Wooley CF. Jacob Mendez DaCosta: medical teacher, clinician, and clinical investigator. Am J Cardiol. 1982 Nov;50(5):1145-8. | PubMed |
Jones E. Historical approaches to post-combat disorders. Philos Trans R Soc Lond B Biol Sci. 2006 Apr 29;361(1468):533-42. | PubMed |
Levine SA. The origin of the term neurocirculatory asthenia. N Engl J Med. 1965 Sep 9;273:604-5. | PubMed |
Chávez I. Cinco Lecciones de Clínica Cardiológica. Méndez Oteo; 1933.
Wood P. Da Costa’s Syndrome: Aetiology. Lecture III. Br Med J. 1941 Jun 7;1(4196):845-51. | PubMed |
Ríos-Martínez BP, Huitrón-Cervantes G, Márquez MF, González-Hermosillo JA, Rangel-Rodríguez GA, Pedraza-Moctezuma LG. Estudio descriptivo de la personalidad y psicopatología en pacientes con síncope vasovagal. Arch Cardiol México. 79(3):207-211. | Link |
Lerma A, Lerma C, Márquez MF, Cárdenas M, Hermosillo AG. Correlation of syncopal burden with anxiety symptoms score in recurrent vasovagal syncope. Int J Cardiol. 2013 Jun 5;166(1):266-7. | CrossRef | PubMed |
Davis SD, Kator SF, Wonnett JA, Pappas BL, Sall JL. Neurally mediated hypotension in fatigued Gulf War veterans: a preliminary report. Am J Med Sci. 2000 Feb;319(2):89-95. | PubMed |
Haley RW, Charuvastra E, Shell WE, Buhner DM, Marshall WW, Biggs MM, et al. Cholinergic autonomic dysfunction in veterans with Gulf War illness: confirmation in a population-based sample. JAMA Neurol. 2013 Feb;70(2):191-200. | CrossRef | PubMed |
Li M, Xu C, Yao W, Mahan CM, Kang HK, Sandbrink F, et al.Self-reported post-exertional fatigue in Gulf War veterans: roles of autonomic testing. Front Neurosci. 2014 Jan 7;7:269. | CrossRef | PubMed |
Morillo CA, Eckberg DL, Ellenbogen KA, Beightol LA, Hoag JB, Tahvanainen KU, et al. Vagal and sympathetic mechanisms in patients with orthostatic vasovagal syncope. Circulation. 1997 Oct 21;96(8):2509-13. | PubMed |
Guzmán CE, Sánchez GM, Márquez MF, Hermosillo AG, Cárdenas M. Differences in heart rate variability between cardioinhibitory and vasodepressor responses to head-up tilt table testing. Arch Med Res. 1999 May-Jun;30(3):203-11. | PubMed |
Kochiadakis G, Marketou M, Koukouraki S, Parthenakis F, Chlouverakis G, Karkavitsas N, et al. Cardiac autonomic disturbances in patients with vasovagal syndrome: comparison between iodine-123-metaiodobenzylguanidine myocardial scintigraphy and heart rate variability. Europace. 2012 Sep;14 (9):1352-8. | CrossRef | PubMed |
Efremov K, Brisinda D, Venuti A, Iantorno E, Cataldi C, Fioravanti F, Fenici R. Heart rate variability analysis during head-up tilt test predicts nitroglycerine-induced syncope. Open Heart. 2014 Jun 14;1(1):e000063. | CrossRef | PubMed |
Shim SH, Park SY, Moon SN, Oh JH, Lee JY, Kim HH, Han JW, et al. Baseline heart rate variability in children and adolescents with vasovagal syncope. Korean J Pediatr. 2014 Apr;57(4):193-8. | CrossRef | PubMed |
Estañol B, Porras-Betancourt M, Padilla-Leyva MÁ, Sentíes-Madrid H. Breve historia del reflejo barorreceptor: de Claude Bernard a Arthur C. Guyton. Ilustrada con algunos experimentos clásicos. Arch Cardiol México. 81(4):330-336. | Link |
Chapleau MW, Cunningham JT, Sullivan MJ, Wachtel RE, Abboud FM. Structural versus functional modulation of the arterial baroreflex. Hypertension. 1995 Aug;26(2):341-7. | PubMed |
Hinghofer-Szalkay H, König EM, Sauseng-Fellegger G, Zambo-Polz C. Biphasic blood volume changes with lower body suction in humans. Am J Physiol. 1992 Oct;263(4 Pt 2):H1270-5. | PubMed |
Hinghofer-Szalkay H, Lackner HK, Rössler A, Narath B, Jantscher A, Goswami N. Hormonal and plasma volume changes after presyncope. Eur J Clin Invest. 2011 Nov;41(11):1180-5. | CrossRef | PubMed |
Charkoudian N, Rabbitts JA. Sympathetic neural mechanisms in human cardiovascular health and disease. Mayo Clin Proc. 2009 Sep;84(9):822-30. | CrossRef | PubMed |
Mosqueda-Garcia R, Furlan R, Fernandez-Violante R, Desai T, Snell M, Jarai Z, et al. Sympathetic and baroreceptor reflex function in neurally mediated syncope evoked by tilt. J Clin Invest. 1997 Jun 1;99(11):2736-44. | PubMed |
Jacob G, Ertl AC, Shannon JR, Furlan R, Robertson RM, Robertson D. Effect of standing on neurohumoral responses and plasma volume in healthy subjects. J Appl Physiol (1985). 1998 Mar;84(3):914-21. | PubMed |
Meredith IT, Eisenhofer G, Lambert GW, Jennings GL, Thompson J, Esler MD. Plasma norepinephrine responses to head-up tilt are misleading in autonomic failure. Hypertension. 1992 Jun;19(6 Pt 2):628-33. | PubMed |
Thorén P. Role of cardiac vagal C-fibers in cardiovascular control. Rev Physiol Biochem Pharmacol. 1979;86:1-94. | PubMed |
Kaufmann H. Neurally mediated syncope: pathogenesis, diagnosis, and treatment. Neurology. 1995 Apr;45(4 Suppl 5):S12-8. | PubMed |
Novak V, Honos G, Schondorf R. Is the heart «empty’ at syncope? J Auton Nerv Syst. 1996 Aug 27;60(1-2):83-92. | PubMed |
Liu JE, Hahn RT, Stein KM, Markowitz SM, Okin PM, Devereux RB, et al. Left ventricular geometry and function preceding neurally mediated syncope. Circulation. 2000 Feb 22;101(7):777-83. | PubMed |
Jardine DL, Ikram H, Frampton CM, Frethey R, Bennett SI, Crozier IG. Autonomic control of vasovagal syncope. Am J Physiol. 1998 Jun;274(6 Pt2):H2110-5. | PubMed |
Béchir M, Binggeli C, Corti R, Chenevard R, Spieker L, Ruschitzka F, et al. Dysfunctional baroreflex regulation of sympathetic nerve activity in patients with vasovagal syncope. Circulation. 2003 Apr 1;107(12):1620-5. | CrossRef | PubMed |
Vaddadi G, Esler MD, Dawood T, Lambert E. Persistence of muscle sympathetic nerve activity during vasovagal syncope. Eur Heart J. 2010 Aug;31 (16):2027-33. | CrossRef | PubMed |
Verheyden B, Liu J, van Dijk N, Westerhof BE, Reybrouck T, Aubert AE, et al. Steep fall in cardiac output is main determinant of hypotension during drug-free and nitroglycerine-induced orthostatic vasovagal syncope. Heart Rhythm. 2008 Dec;5(12):1695-701. | CrossRef | PubMed |
Vaddadi G, Guo L, Esler M, Socratous F, Schlaich M, Chopra R, et al. Recurrent postural vasovagal syncope: sympathetic nervous system phenotypes. Circ Arrhythm Electrophysiol. 2011 Oct;4(5):711-8. | CrossRef | PubMed |
Márquez MF, Urias KI, Hermosillo AG, Jardón JL, Iturralde P, Colín L, et al. Familial vasovagal syncope. Europace. 2005 Sep;7(5):472-4. | PubMed |
Márquez MF, Hernández-Pacheco G, Hermosillo AG, Gómez JR, Cárdenas M, Vargas-Alarcón G. The Arg389Gly beta1-adrenergic receptor gene polymorphism and susceptibility to faint during head-up tilt test. Europace. 2007 Aug;9(8):585-8. | PubMed |
Hernández-Pacheco G, González-Hermosillo A, Murata C, Yescas P, Espínola-Zavaleta N, Martínez M, et al. Arg347Cys polymorphism of α1a-adrenergic receptor in vasovagal syncope. Case-control study in a Mexican population. Auton Neurosci. 2014 Jul;183:66-71. | CrossRef | PubMed |
Márquez MF, Urias-Medina K, Gómez-Flores J, Sobrino A, Sotomayor-González A, González-Hermosillo A, et al. [Comparison of metoprolol vs clonazepam as a first treatment choice among patients with neurocardiogenic syncope]. Gac Med Mex. 2008 Nov-Dec;144(6):503-7. | PubMed |
Sheldon R, Connolly S, Rose S, Klingenheben T, Krahn A, Morillo C, et al. Prevention of Syncope Trial (POST): a randomized, placebo-controlled study of metoprolol in the prevention of vasovagal syncope. Circulation. 2006 Mar 7;113(9):1164-70. | PubMed |
Sheldon RS, Morillo CA, Klingenheben T, Krahn AD, Sheldon A, Rose MS. Age-dependent effect of β-blockers in preventing vasovagal syncope. Circ Arrhythm Electrophysiol. 2012 Oct;5(5):920-6. | CrossRef | PubMed |
Benditt DG, Detloff BL, Adkisson WO, Lu F, Sakaguchi S, Schussler S, et al. Age-dependence of relative change in circulating epinephrine and norepinephrine concentrations during tilt-induced vasovagal syncope. Heart Rhythm. 2012 Nov;9(11):1847-52. | CrossRef | PubMed |
Raj SR, Faris PD, Semeniuk L, Manns B, Krahn AD, Morillo CA, et al. Rationale for the Assessment of Metoprolol in the Prevention of Vasovagal Syncope in Aging Subjects Trial (POST5). Am Heart J. 2016 Apr;174:89-94. | CrossRef | PubMed |
Raj SR, Coffin ST. Medical therapy and physical maneuvers in the treatment of the vasovagal syncope and orthostatic hypotension. Prog Cardiovasc Dis. 2013 Jan-Feb;55(4):425-33. | CrossRef | PubMed |
Vyas A, Swaminathan PD, Zimmerman MB, Olshansky B. Are treatments for vasovagal syncope effective? A meta-analysis. Int J Cardiol. 2013 Sep 1;167(5):1906-11. | CrossRef | PubMed |
Romme JJ, Reitsma JB, Black CN, Colman N, Scholten RJ, Wieling W, et al. Drugs and pacemakers for vasovagal, carotid sinus and situational syncope. Cochrane Database Syst Rev. 2011 Oct 5;(10):CD004194. | CrossRef | PubMed |
Pérez V, Puiigdemont D, Gilaberte I, Alvarez E, Artigas F; Grup de Recerca en Trastorns Afectius. Augmentation of fluoxetine’s antidepressant action by pindolol: analysis of clinical, pharmacokinetic, and methodologic factors. J Clin Psychopharmacol. 2001 Feb;21(1):36-45. | PubMed |
Goldstein DS, Holmes C, Frank SM, Dendi R, Cannon RO 3rd, Sharabi Y, et al. Cardiac sympathetic dysautonomia in chronic orthostatic intolerance syndromes. Circulation. 2002 Oct 29;106(18):2358-65. | PubMed |
Schroeder C, Tank J, Boschmann M, et al. Selective norepinephrine reuptake inhibition as a human model of orthostatic intolerance. Circulation. 2002 Jan 22;105(3):347-53. | CrossRef | PubMed |
Schroeder C, Birkenfeld AL, Mayer AF, Tank J, Diedrich A, Luft FC, et al. Norepinephrine transporter inhibition prevents tilt-induced pre-syncope. J Am Coll Cardiol. 2006 Aug 1;48(3):516-22. | PubMed |
Schroeder C, Jordan J. Norepinephrine transporter function and human cardiovascular disease. Am J Physiol Heart Circ Physiol. 2012 Dec 1;30(11):H1273-82. | CrossRef | PubMed |
Sheldon RS, Ritchie D, McRae M, Raj S. Norepinephrine transport inhibition for treatment of vasovagal syncope. J Cardiovasc Electrophysiol. 2013 Jul;24(7):799-803. | CrossRef | PubMed |
Ramirez CE, Okamoto LE, Arnold AC, Gamboa A, Diedrich A, Choi L, et al. Efficacy of atomoxetine versus midodrine for the treatment of orthostatic hypotension in autonomic failure. Hypertension. 2014 Dec;64(6):1235-40. | CrossRef | PubMed |

El síncope vasovagal.

Filed under: General,vasculo cerebral,Vegetativo — Enrique Rubio @ 21:20

El síncope vasovagal.
El síncope vasovagal es un tipo de intolerancia ortostática. Este término se usa para referirse al síncope que resulta de mecanismos reflejos asociados con vasodilatación inapropiada y grados variables de bradicardia. También es conocido como síncope reflejo, síncope neurocardiogénico o síncope neuralmente mediado.
El síncope es un problema clínicamente significativo, responsable del 1% de las admisiones hospitalarias y 3% de las visitas a las salas de urgencias, con una morbilidad y mortalidad superior al 7% [3],[4]. El síncope es una manifestación de diferentes procesos y por lo tanto debe ser visto como un síntoma y no una enfermedad, y debe ser clasificado de acuerdo a la causa de base.
El 40% de la población general sufre de al menos un episodio de síncope a lo largo de su vida [6]. El síncope vasovagal es el tipo más común de síncope. La incidencia pico se da en la adolescencia. La mayoría de los pacientes con síncope vasovagal son mujeres jóvenes entre 15 y 45 años de edad. El síncope vasovagal puede ser resultado de algún tipo de estrés emocional (el cual se comporta como gatillo) o cambio de postura, tal como el adoptar de forma repentina la posición de pie. El síncope vasovagal generalmente va precedido por sensación de mareo, debilidad, náusea, diaforesis o problemas visuales. Es interesante remarcar que el síncope vasovagal, síndrome de taquicardia postural ortostática, el síndrome de fatiga crónica y la fibromialgia tienen una causa de base en común: una disfunción del sistema nervioso autónomo, y por lo tanto se agrupan en un término: “Disautonomías” [7],[8]. El sistema nervioso autónomo regula funciones fisiológicas que no dependen de la consciencia (digestión, frecuencia cardiaca, presión arterial, etcétera). Consiste en dos subsistemas: el simpático y el parasimpático (o vagal). El primero es un estimulante de funciones neurovegetativas mientras que el segundo las deprime. Son tradicionalmente vistos como sistemas antagonistas y normalmente están en equilibrio: si uno está activo el otro es inhibido para compensar. Cuando se pierde este balance, pueden aparecer diversos síntomas incluyendo disnea, taquicardia, fatiga, parestesia, mareo, dolor muscular, síndrome de intestino irritable, dolor torácico, ansiedad, depresión y/o síncope. La manifestación del síncope y la presencia de manifestaciones clínicas de intolerancia ortostática (fatiga, mareo, etcétera) son de gran importancia y magnitud puesto que pueden conducir a una incapacidad [9]; por lo tanto, cualquier intento para disminuirlos o evitarlos debe ser tomado en consideración .
Fisiopatología del síncope vasovagal

Existen resultados controversiales respecto a parámetros basales del tono autonómico entre pacientes con síncope y los controles (individuos sanos). La Tabla 1 [23],[24],[25],[26],[27] muestra una lista de estudios que incluyen dominios de tiempo y frecuencia, variabilidad de frecuencia cardiaca y microneurografía. La mayoría han fallado en demostrar una diferencia en los valores medios de los índices de variabilidad de frecuencia cardiaca entre sujetos normales y pacientes con síncope vasovagal. Solamente Shim et al [27] encontraron evidencia de un incremento en el tono vagal basal en niños con síncope vasovagal.
Estar de pie debería es un esfuerzo para nuestras capacidades reguladoras de la circulación; y para ello se requiere el buen funcionamiento del corazón, los vasos sanguíneos, y el sistema nervioso autónomo estén intactos. También es relevante un volumen sanguíneo adecuado y la habilidad de los músculos esqueléticos de las piernas para comprimir las venas y facilitar el regreso de la sangre al corazón. El cambio de la posición decúbito a ortostática resulta en la acumulación de 300 a 800 ml de sangre en las extremidades inferiores y la circulación esplácnica, causando hipovolemia central, debido a una disminución en el retorno venoso al corazón con reducción concomitante del llenado ventricular izquierdo (precarga), con caída transitoria del volumen de salida del ventrículo izquierdo y la presión arterial.
La actividad del sistema nervioso simpático es regulada en primer lugar por mecanorreceptores (barorreceptores), los cuales detectan cambios en la presión arterial, y en un grado menor por quimiorreceptores. Los barorreceptores arteriales (receptores de alta presión) están localizados en el seno carotideo y arco aórtico, y los barorreceptores cardiopulmonares (receptores de baja presión) en las grandes venas, aurículas (receptores A y B, reflejo de Bainbridge [un incremento en la presión o una distención aumentada de la aurícula derecho causa aceleración del latido cardiaco, también llamado “efecto Bainbridge”]), y ventrículos (reflejo Bezold-Jarisch). En estos mecanorreceptores, los canales iónicos son activados por estiramiento y modulan la actividad eferente simpática mandando información aferente al núcleo del tracto solitario (tractus solitarius) [29].
Los barorreceptores responden a la disminución en el retorno venoso y presión arterial que ocurre al momento de tomar la posición de pie con un incremento en la actividad simpática eferente y una disminución en el tono p arasimpático, lo cual resulta en un incremento de la frecuencia cardiaca e inotropismo, así como vasoconstricción arterial periférica. Por lo tanto, la hipovolemia central transitoria con una caída transitoria concomitante del volumen de salida del ventrículo izquierdo resulta en una distención más baja de los barorreceptores del seno carotídeo y el arco aórtico, con una reducción de la actividad barorrefleja aferente al tronco cerebral, con una consecuente activación simpática eferente e inhibición parasimpática que finalmente incrementa la frecuencia cardiaca y la resistencia vascular periférica, en un intento, por lo general exitoso, de restaurar el volumen de salida cardiaco y la presión arterial. Para ayudar a minimizar la reducción en la presión arterial ortostática, se ha descrito un incremento en la reabsorción de fluidos asociada con un incremento en resistencias periféricas totales [30],[31]. Tras una recuperación de la caída inicial de la presión arterial durante el ortostatismo, el volumen sanguíneo disminuye lentamente debido a la filtración microvascular.
En condiciones normales, el estrés ortostático evoca vasoconstricción compensatoria en múltiples lechos vasculares incluyendo los músculos esqueléticos. La actividad de los nervios simpáticos de los músculos se podría registrar en los humanos por microneurografía; se trata de una evaluación directa de la actividad nerviosa simpática en individuos conscientes [32] y está estrechamente ligada a la presión arterial vía el mecanismo barorreflejo de cada persona. En respuesta a una inclinación progresiva, en individuos sanos esta actividad simpática incrementa y se correlaciona con el grado de inclinación [33].
La correlación estrecha entre la frecuencia cardiaca y la concentración de adrenalina plasmática descrita por Jacob [34] sugiere que esto puede provocar el incremento en la frecuencia cardiaca durante los primeros minutos del reto ortostático. El incremento en las concentraciones plasmáticas de noradrenalina estimula los receptores alfa-1 adrenérgicos e induce vasoconstricción. El incremento en la actividad de renina y aldosterona ejerce múltiples efectos compensatorios para mantener la postura: incremento en la reabsorción tubular renal de sodio, vasoconstricción directa y facilitamiento de la descarga de noradrenalina actuando en neuronas noradrenérgicas presinápticas, y posiblemente en el sistema nervioso central.
Dada la importancia del sistema nervioso simpático en regular la respuesta a los cambios posturales, se ha considerado que diversos grados de disfunción simpática están involucrados en la intolerancia ortostática. Los primeros estudios en investigar la fisiopatología del síncope vasovagal mostraron que un reflejo paradójico y compensatorio estaba involucrado. La llamada “teoría ventricular” postula que los barorreceptores reaccionan a la disminución en la presión arterial con una activación del sistema nervioso simpático, causando una mayor respuesta inotrópica y cronotrópica, así como vasoconstricción periférica La interrupción abrupta de la actividad nerviosa simpática de la vasculatura de los músculos esqueléticos, representando una “caída” simpática, ha sido considerado un paso importante para la vasodilatación que lleva a la hipotensión. Estudios previos mostraron que previo al síncope vasovagal, la actividad simpática eferente medida con microneurografía, disminuía progresivamente o era interrumpida de forma abrupta [40]. Esta reducción en la actividad simpática estuvo directamente relacionada con la presión arterial media, mientras que la actividad parasimpática medida por análisis espectral de la variabilidad de la frecuencia cardiaca permaneció por debajo de la opinión y que lo basal, sugiriendo que el control simpático de la resistencia periférica total fue el mecanismo responsable del síncope vasovagal. En un estudio reciente conducido en 56 pacientes con sospecha de síncope vasovagal, bajo una prueba de inclinación, se observó una reducción del 50% en la fracción de expulsión, mientras que las resistencias vasculares sistémicas permanecieron estables hasta que se presentó el presíncope [43].
Luego a para Vaddadi y colaboradores [44] compararon dos grupos de pacientes con síncope vasovagal: aquellos con presión arterial normal en decúbito (sistólica>100 mmHg) con aquellos con presión arterial baja en decúbito (sistólica≤ 100 mmHg). Una expresión aumentada del transportador de noradrenalina podría depurar noradrenalina de una forma más rápida, reduciendo la vasoconstricción compensatoria y predisponiendo a hipotensión postural.
Kochiadakis y colaboradores [25] mostraron que pacientes con síncope vasovagal tuvieron un alto grado de disturbio en la inervación miocárdica adrenérgica y múltiples defectos en la inervación adrenérgica. La tasa de aclaramiento incrementada pudiera también reflejar un aumento en la actividad nerviosa simpática cardiaca.
Los pacientes con síncope vasovagal frecuentemente tienen un familiar de primer grado también afectado [45]. Aunque la participación de la genética en el síncope vasovagal ha sido discutida, alguna evidencia sugiere que hay un componente genético mayor: los receptores adrenérgicos. Los estudios muestran una asociación entre prueba de inclinación positiva en pacientes con síncope y la presencia de polimorfismos de dos receptores adrenérgicos, el Arg389Gly de beta-1 [46] y el Arg347Cys del alfa-1a (α1a) [47]. Desgraciadamente, estos hallazgos no se han reproducido.
Los betabloqueadores fueran empleados en el tratamiento del síncope vasovagal desde el inicio [48]. Pero todos los estudios publicados tienen una muestra pequeña; algunos de ellos incluyeron menos de 10 pacientes. También es importante mencionar que el seguimiento fue corto (Tabla 2) en la mayoría de ellos. El único estudio aleatorizado con un tamaño de muestra adecuado fue síndrome de taquicardia postural ortostática [49] y no pudo demostrar ningún beneficio con el uso de betabloqueadores. y Coffin [53], propusieron que los betabloqueadores pueden ser una opción terapéutica razonable para pacientes con síncope vasovagal e hipertensión arterial sistémica.
Vyas y colaboradores [54] publicaron un metanálisis de todos los estudios sobre diferentes opciones de tratamiento en el síncope vasovagal. Se incluyeron trece estudios en el análisis de pacientes tratados con betabloqueadores. En este metanálisis hubo diferencias significativas a favor de los betabloqueadores cuando se lanzaron los 13 estudios. Una revisión sistemática de la literatura mostró que el tratamiento con betabloqueadores fue significativamente mejor en comparación con la terapia estándar. Sin embargo, no se encontraron diferencias en todos los estudios al compararlos con placebo, otros fármacos o marcapasos [55].
Algunos aspectos que no pueden ser cubiertos por el metanálisis y revisiones sistemáticas con las diferentes propiedades farmacológicas de los betabloqueadores. El factor más relevante en sujetos con síncope vasovagal es la actividad simpática intrínseca, lo cual limita el efecto de bradicardia de algunos betabloqueadores tal como el pindolol. Aunque este efecto puede ser útil para evitar más bradicardia en sujetos con tendencia a frecuencia cardiaca baja, también puede estar asociado con palpitaciones, lo cual puede limitar su uso. A este respecto, la titulación de la dosis es un factor muy importante que no se ha tomado en cuenta en estudios previos. También es importante para la especificidad a los órganos objetivo de los betabloqueadores. Las diferencias entre antagonistas no selectivos (con o sin actividad alfa antagonista) en comparación con el selectivo beta-antagonista-1 tampoco han sido abordados de forma adecuada. El uso de agentes con actividad vasodilatadora arteriolar (ej. labetalol, carvedilol, nebivolol) puede ser más util en el subgrupo de pacientes que también sufren de hipertensión reactiva, pero podría dañar a pacientes propensos a presión arterial baja. Finalmente, la afinidad de algunso betabloqueadores, tal como pindolol, para el subtipo de receptors de serotonina 1A (5-HT1A) para depresión pudiera también ser parte del efecto en el síncope vasovagal [56].
La recaptación de noradrenalina en la hendidura sináptica, hecha posible por el transportador de noradrenalina, es el mecanismo principal de inactivación de esta catecolamina. Por lo tanto, la acción del transportador de noradrenalina es un factor clave en su regulación. Concentraciones aumentadas del transportador de noradrenalina o un incremento en su función resultarían en una inactivación mayor de noradrenalina y viceversa (una disminución en su concentración o menor actividad del transportador de noradrenalina implicaría mayor acción de los receptores adrenérgicos). En un caso con síndrome de taquicardia postural ortostática, Goldstein y colaboradores [57] encontraron una mutación que disminuyó la función del transportador de noradrenalina en 98%, demostrando por primera vez una relación entre una función disminuida de este transportador con hiperactividad simpática clínica, manifestada por taquicardia postural.
Por otro lado, una actividad incrementada del transportador de noradrenalina, aclarando más rápidamente el neurotransmisor, reduciría la vasoconstricción compensadora predisponiendo a hipotensión ortostática. Esta posibilidad teórica es apoyada por diversos estudios. Schroeder y colaboradores [58] mostraron una mejor tolerancia a la prueba de inclinación bajo tratamiento con inhibidor del transportador de noradrenalina (reboxetina) comparada con placebo en 18 sujetos sanos. La reboxetina es un fármaco que es usado como antidepresivo. Bajo placebo, ocurrió una reacción vagal en el 50% de los individuos (9 de 18), mientras que sólo un individuo sufrió desmayo (5%) bajo reboxetina. Expandieron su observación con 51 sujetos sanos sin historia de síncope [59]. En este grupo, compararon dos inhibidores del transportador de noradrenalina: sibutramina (un fármaco usado para pérdida de peso) o reboxetina. Mostraron nuevamente una mayor tolerancia al ortostatismo pasivo durante la prueba de inclinación; la duración de la prueba antes de que el paciente presentara reacción vagal incrementó de 29 ± 2 a 35 ± 1 min (p = 0,001) cuando el sujeto estaba bajo el efecto de cualquiera de estos dos inhibidores. Una excelente revisión de estos hallazgos y sus implicaciones fue expuesto por el principal autor de estos trabajos en el 2012 [60]. Sheldon y colaboradores [61] reportaron que cinco de siete pacientes muy sintomáticos con múltiple recurrencia de síncope vasovagal (32 eventos en promedio por mes) tratados con sibutramina mostraron una reducción en la frecuencia de desmayos por más del 50%.
Se retiró la sibutramina del mercado en muchos países, incluyendo México, al mostrar un estudio incremento en la tasa de eventos cardiovasculares (infarto agudo al miocardio y evento vascular cerebral) en personas con enfermedad cardiaca previa. Ramírez y colaboradores [62] reportaron que la atomoxetina, un inhibidor del transportador de noradrenalina aprobado para el tratamiento del déficit de atención, podía incrementar la presión arterial en individuos con falla autonómica. La atomoxetina fue aún mejor que la midodrina en mejorar la presión arterial al adoptar la posición ortostática en un grupo de 65 pacientes con falla autonómica severa (causado por enfermedad de Parkinson, atrofia múltiple sistémica o falla autonómica pura). Por lo tanto, la atomoxetina podría ser una opción terapéutica para síncope vasovagal dada su disponibilidad en muchos países en la posibilidad de utilizar dosis pediátricas.
Conclusiones
Los betabloqueadores son considerados un placebo porque no hay evidencia fuerte sobre su uso. Sin embargo, se necesitan con urgencia más estudios sobre el uso de betabloqueadores en síncope vasovagal basados en la información presentada en este documento y en el hecho de que aún son usados en la práctica clínica dada la excelente respuesta reportada por expertos clínicos. Un estudio multicéntrico (POST-5) se está llevando a cabo en un intento de probar esta hipótesis. Estudios recientes en la inhibición de la recaptación de noradrenalina con agentes específicos han mostrado resultados prometedores en esta entidad y ameritan más investigación.

18 febrero 2020

Lactato y cáncer

Filed under: TUMORES — Enrique Rubio @ 21:19

EL LACTATO PUEDE PROVOCAR CÁNCER

En 2017 los investigadores Iñigo San Millán, de la Universidad de Colorado Springs, y George Brooks, de la Universidad de Berkeley, publicaron la hipótesis de que el lactato jugaba un papel muy importante en el desarrollo del cáncer. De hecho, San Millán y Brooks declaraban en ese momento que el lactato era el único componente metabólico presente y necesario en todas las etapas del cáncer.
En su hipótesis, los científicos explicaron el efecto Warburg por primera vez. Este efecto fue descubierto por el premio Nobel Otto Warburg en 1923 y asociaba exceso de lactato en el cuerpo con cáncer. Sin embargo, no se sabía el porqué de esa presencia. San Millán y Brooks descubrieron que el lactato se producía para desarrollar cáncer.
Los investigadores han seguido trabajando en esa línea y han conseguido demostrar su hipótesis: el lactato que se acumula (el que se relaciona con el cáncer) activa los principales genes mutados involucrados en el crecimiento y proliferación del cáncer. “De hecho, si estos genes mutados no están expuestos al lactato, tienen difícil el cometido de producir cáncer. Por ejemplo, el premio Nobel del año pasado se lo han dado a tres investigadores por su trabajo en el factor de transcripción HIF-1 el cual, cuando está mutado, es elemento fundamental en el desarrollo de muchos cánceres. Todavía no está muy claro qué activa la producción del HIF-1 en cáncer. En nuestro estudio hemos descubierto que el lactato regula directamente la expresión de HIF-1 entre un 290-480%”, nos cuenta San Millán.
Los resultados del nuevo estudio han sido recientemente publicados en la revista Frontiers in Oncology. En esta investigación los científicos expusieron células de mama humanas cancerosas a glucosa y se produjo lactato. Este aumentó la expresión de todos los principales genes mutados involucrados en el cáncer de mama entre un 150-800%.
Ahora, San Millán y su equipo están reproduciendo este estudio en otros cánceres como el de pulmón de células pequeñas y el de pulmón no microcítico. Están encontrando resultados similares al de mama.
El lactato es fundamental para el crecimiento del tumor ya que activa los principales genes mutados involucrados en el crecimiento y proliferación del cáncer.

Pero ¿qué es exactamente el lactato o ácido láctico? ¿Cómo funciona? ¿Qué lo produce? Vayamos por partes… El lactato es un producto que se obtiene de la combustión de la glucosa (bien obtenida de los alimentos que ingerimos, bien por la movilización del glucógeno almacenado en los músculos y el hígado) y que las células consumen para obtener energía. Es más, el lactato es una de las mayores fuentes de energía de las células. Destacar que cerebro y corazón son dos de los grandes consumidores de lactato de nuestro organismo.
Sobre cómo funciona el lactato, San Millán nos lo resume: “La dinámica del lactato es muy estable en general. Entra en las células y se convierte en energía pero no se acumula. Sin embargo, en el cáncer, parte de ese lactato se convierte en energía pero la mayoría se acumula constantemente en el sitio donde el tumor se produce. Lo que hemos descubierto es que este lactato que se acumula es fundamental para el crecimiento del tumor ya que activa los principales genes mutados involucrados en el crecimiento y proliferación del cáncer”.
Cuando hacemos ejercicio también producimos lactato, lo que nos podría llevar a pensar que con su práctica estaríamos avivando al cáncer. Pues bien, no hay nada que temer pues tal y como nos indica el investigador español, el lactato que fabricamos mientras corremos, jugamos al fútbol o nos machacamos en el gimnasio no se acumula sino que se convierte en energía y desaparece del músculo en minutos. Además, este lactato crea respuestas positivas para mejorar el rendimiento y la forma física. “Sin embargo, el lactato en el cáncer se acumula constantemente, no se “recicla” y como hemos demostrado se “desregula” y empieza a activar a los genes involucrados en el cáncer para que prosigan con su función de transformar células normales a células cancerígenas, así como para la función de crecimiento y proliferación del tumor”, nos explica. Así que ya lo sabes, el ejercicio adaptado a las condiciones personales de cada uno y bajo supervisión médica es bueno.
Otra duda que nos surge acerca del lactato es si reduciendo nuestra ingesta de azúcar y de hidratos de carbono, limitaríamos la cantidad de glucosa en nuestro organismo y con ella la posibilidad de que se produzca lactato. La respuesta no es sencilla. Para empezar, el cáncer, cuanto más agresivo es, más glucosa necesita y si esta no se encuentra a su disposición, se la va a robar al cuerpo y a los músculos. Al robar la glucosa de los músculos, se puede producir caquexia, es decir, la pérdida de masa muscular en pacientes con cáncer. De nuevo, cuanto más grave es el cáncer, mayor necesidad de glucosa tiene y mayor caquexia produce. Para que nos entendamos, los músculos se comerían a ellos mismos para producir la glucosa que la enfermedad requiere. “Por tanto hay que tener cuidado en restringir los carbohidratos en pacientes con cánceres ya que podría acentuar la caquexia en muchos de ellos. Estoy acabando un estudio con pacientes de cáncer con el hospital MD Anderson en Houston (el número 1 del mundo en cáncer) y efectivamente, estamos viendo que los pacientes con cáncer más avanzado y caquexia poseen significativamente menos cantidad de glucógeno que los pacientes sin caquexia y los pacientes sin cáncer. Todavía se necesita mucha investigación en este aspecto. No estoy diciendo que hay que aumentar el consumo de glucosa para nada, pero que restringir carbohidratos en estados de cáncer podría ser peligroso”, apunta el investigador español.
Siguientes pasos
El equipo de San Millán y Brooks está ahora tratando de bloquear el lactato y disminuir su producción. “Si logramos bloquear el lactato, acabaríamos con el cáncer ya que este se quedaría sin su “visa” o “pasaporte”. El problema es que todas las células consumen y producen lactato y si bloqueamos de forma sistémica al lactato, muy probablemente sería letal. Por tanto, nos estamos centrando en intentar bloquear exclusivamente el lactato presente en los tumores. De momento, en células de cáncer de mama así como de cáncer de pulmón estamos viendo una reducción in vitro en la proliferación y supervivencia de esas células cancerígenas de entre un 60-85% en tan solo 48h. Ahora hemos pasado a la fase in vivo, hemos implantado estos tumores en ratones y hemos empezado a estudiar la evolución de esos tumores. Estamos ya desarrollando nuevos abordajes para llegar al tumor de forma localizada y bloquear el lactato, aunque como toda la investigación lleva tiempo en probarla y luego en ser terapia exitosa”, concluye San Millán
Bibliografía
Iñigo San Millán, de la Universidad de Colorado Springs, y George Brooks, de la Universidad de Berkeley, publicaron la hipótesis de que el lactato jugaba un papel muy importante en el desarrollo del cáncer

17 febrero 2020

INSTITUTO SMITHSONIANO DESTRUYE LOS ESQUELETOS GIGANTES

Filed under: ANATOMIA — Enrique Rubio @ 21:43

INSTITUTO SMITHSONIANO DESTRUYE LOS ESQUELETOS GIGANTES
Nativos junto a un hombre de estatura media.
A finales del siglo XX, The New York Times, London Globe y Scientific American publicaron artículos que divulgaban el descubrimiento de esqueletos humanos gigantescos y concluyeron que los restos se enviaron al Instituto Smithsoniano (Smithsonian) para un estudio adicional. Pero el hecho de que esta evidencia nunca se volvió a ver o divulgar, continúa provocando dudas sobre si el Smithsonian ha destruido los esqueletos gigantes para encubrir una anomalía que pondría en aprietos a la narrativa arqueológica oficial con la que hemos sido programados por las élites y sus gobiernos.

Un El Instituto Smithsoniano es un centro de educación e investigación que posee además un complejo de museos asociado. Está administrado y financiado por el Gobierno de los Estados Unidos, y prácticamente es una extensión del mismo pues su Junta de Regentes está conformada por miembros del Congreso.
El tema de los esqueletos gigantes se ha debatido acaloradamente durante el último siglo o más, y los investigadores han encontrado lo que parece ser una evidencia que corrobora su existencia, mientras que los escépticos dicen que los huesos eran simplemente los de animales prehistóricos masivos, reclasificados por el Smithsonian y exhibidos en museos hasta el día de hoy. Mientras que la evidencia física sigue siendo limitada, hay un rastro aparentemente interminable de sugerencias anecdóticas y escritas de que una raza más grande de humanos caminó por la Tierra.
Breve historia del Instituto Smithsoniano
Aunque no parezca obvio, el Instituto Smithsoniano es una extensión del gobierno de los Estados Unidos con miembros del Congreso que forman parte de su Junta de Regentes. Inicialmente se fundó como “un establecimiento para el aumento y la difusión del conocimiento entre los hombres”, en la dotación del filántropo, químico y mineralogista James Smithson.
Y si bien no es una agencia reguladora, está tan intrínsecamente ligada al gobierno que reclama la inmunidad de las regulaciones estatales y locales, así como la inmunidad de las demandas legales a menos que el Congreso lo autorice.
El Smithsonian se estableció en 1846 y se le encomendó la misión de organizar la historia antropológica de los Estados Unidos. A veces se le conoce como “el ático de la nación”, ya que se han acumulado hasta 154 millones de artículos entre sus innumerables museos, centros de investigación y diversas instalaciones.

Pero al tratarse de una agencia gubernamental que ha estado influyendo en el curso de la historia desde los días eurocéntricos del destino manifiesto, uno debería ser muy escéptico sobre qué tipo de “conocimiento difuso” se ha difundido a través de esta institución, y a qué poderes ha servido.
Richard Dewhurst, autor de Los Gigantes Antiguos que gobernaron América, señala a un hombre llamado John Wesley Powell, quien fue Director de Etnología de los EE.UU. en 1879 y dirigió el Instituto Smithsoniano en sus años nacientes. En su investigación, Dewhurst descubrió lo que él llama la Doctrina Powell, un documento publicado en nombre del Instituto Smithsoniano, que emitió un decreto de que ninguna investigación antropológica debería considerar cualquier charla de tribus perdidas a partir de ahora, mientras que también describe a los nativos como incultos, salvajes, y carente de signos de intelecto superior.
“Por lo tanto, se verá que es ilegítimo utilizar cualquier material pictográfico de una fecha anterior al descubrimiento del continente por parte de Colón con fines históricos”, escribió Powell.
No está claro si esta fue una decisión de Powell o si se debió a instrucciones que le fueron impuestas. Sin embargo, Dewhurst cree que su claro tono de destino manifiesto llevó al subsiguiente encubrimiento en el Instituto Smithsoniano de una antigua raza de gigantes que precedió a los nativos americanos.
Instituto Smithsoniano destruye esqueletos gigantes
Mirando hacia atrás a los recortes de periódicos que datan desde finales de 1800 hasta principios de 1900, Dewhurst encontró una multitud de casos en los que los ciudadanos de áreas dispares del país descubrieron huesos masivos, de origen aparentemente humano. Al informar sobre estos descubrimientos a los medios de comunicación o autoridades, Dewhurst dijo que los ciudadanos desprevenidos pronto recibieron visitas de miembros del Instituto Smithsoniano que no perdieron tiempo en secuestrar los huesos, con la excusa de llevarlos a un museo o centro de investigación. Pero los esqueletos nunca volvieron a verse.
También se pueden encontrar casos de cráneos y esqueletos gigantes en periódicos locales con fotos para arrancar. Tomemos, por ejemplo, esta foto de San Antonio Press que muestra un cráneo gigante junto a dos cráneos normales para la comparación de tamaños.

Vale la pena mencionar que el período de tiempo en el que se encontraron estos restos óseos fue drásticamente diferente al de hoy: el periodismo amarillo era desenfrenado incluso para algunas de las publicaciones que podríamos considerar más estimadas.
¿Esqueletos gigantes nephilim?
La religión también fue un factor dominante en la vida de muchas personas y los intentos de encontrar ejemplos literales de historias bíblicas fueron muy buscados. Este se ha convertido en uno de los principales argumentos en contra de estos relatos, ya que los detractores creen que las personas crearon esqueletos falsificados o confundieron los huesos de la megafauna prehistórica y los grandes animales para los humanos, con la esperanza de que hubieran encontrado pruebas de la existencia de la especie Nephilim del Antiguo Testamento.
¿Gigantes descubiertos alrededor del mundo?
Los Estados Unidos no son el único país en el que se dice que se han encontrado estos supuestos gigantes de la antigüedad. De hecho, hay vestigios que datan de varios milenios, que hablan de encuentros con gigantes vivientes o reliquias que aluden a su existencia.
En la mina de cobre prehistórica más grande del mundo en Gales, hay informes sobre el descubrimiento de miles de martillos gigantes cuyo peso supuestamente está en el rango de los 27 kilogramos.
La validez de esa información es discutible. Aunque si fuera cierto, se requeriría un ser humano más grande y con una fuerza increíble para haber podido manejar una herramienta de este tipo para trabajar en una mina. Un martillo promedio hoy en día no pesa más de 9 kilogramos. Este repositorio, conocido como la mina Great Orme o el “Stonehenge de la minería del cobre”, se remonta a hace unos 3.500 años.
Otro ejemplo más conocido de supuestos gigantes proviene de los escritos del cronista de Ferdinand Magellan, Antonio Pigafetta, quien escribió sobre una raza gigante al descubrir la Patagonia.
“Un día, de repente, vimos a un hombre desnudo de talla gigante en la orilla del puerto, bailando, cantando y arrojando polvo sobre su cabeza”, escribió Pigafetta.
“El capitán general envió a uno de nuestros hombres con el gigante para que realizara las mismas acciones como un signo de paz. Una vez hecho esto, el hombre condujo al gigante a un islote donde el capitán general estaba esperando. Cuando el gigante se presentó ante el capitán general, se maravilló enormemente e hizo señales con un dedo levantado, creyendo que habíamos venido del cielo. Era tan alto que solo llegamos a su cintura, y estaba bien proporcionado.”
Según los escritos de Pigafetta, Magellan y su tripulación intentaron regresar a Italia con dos de los gigantes que habían encontrado, aunque no pudieron sobrevivir al largo viaje de regreso a través del Atlántico.
Los escépticos dicen que las personas a las que se hace referencia en estos relatos probablemente eran miembros de los tehuelches, una tribu nativa que puede haber tenido una estatura ligeramente mayor debido a la fuerza necesaria para sobrevivir en el duro clima de la Patagonia, aunque es cuestionable si tenían una altura mucho mayor que el humano promedio.
Pero, de hecho, hay una serie de fotografías de finales de la década de 1800 que muestran a los miembros de la tribu Ona que habitaban la región de Tierra del Fuego en la Patagonia, en las que se observa claramente que eran significativamente más altos que la mayoría de los humanos, con mujeres 1.98 metros de altura y hombres de más de 2 metros. Nativos ona junto a un hombre de estatura media.

Este relato también ha sido cuestionado ya que algunos dicen que puede haber sido simplemente una instancia de gigantismo, con informes posteriores embellecidos para hacer que los viajes de Magellan parecieran más emocionantes.
Sin embargo, el relato fue confirmado posteriormente por el explorador inglés James Byron, en cuyo relato —publicado por el London Chronicle— menciona haber encontrado una raza de gigantes de dos metros en la Patagonia. Otros escritos de las expediciones de Sir Francis Drake, Francis Fletcher y Sir Thomas Cavendish también informaron sobre imponentes patagones y sus cuerpos fallecidos.
¿Podrían estas tribus nativas corroborar las historias cuestionables de los antiguos exploradores europeos?
¿Todavía escéptico sobre la supuesta existencia de humanos gigantes en la Tierra? Echa un vistazo a este documental A Race of Giants:
El documental “Raza de gigantes”, disponible en Gaia, también expone la existencia de humanos gigantes sobre la Tierra.
UFO – OVNI #proyectoalphacrucis·Monday, December 31, 2018

Older Posts »

Powered by WordPress