Enriquerubio.net El blog del Dr. Enrique Rubio

23 febrero 2020

Los telómeros María Blasco

Filed under: GENES — Enrique Rubio @ 14:17

LOS TELÓMEROS
“ La bióloga María Blasco , directora del Centro Nacional de Investigaciones Oncológicas (CNIO), que ha dedicado toda su carrera a estudiar los telómeros y a aclarar qué relación tienen con el cáncer y la longevidad. En una de sus últimas investigaciones, publicada en la revista PNAS , ha averiguado cómo los telómeros regulan la longevidad de las especies.
Creo que los investigadores en general se lo pasan muy bien buscando. Cuando leo los estudios de los investigadores y sobre todo investigadoras y el placer que le produce no solo el hallazgo, sino sobre todo la búsqueda, siento verdadera envidia y me siento todo lo feliz que yo puedo ser, porque he llegado a mayor y sigo enamorado de las ciencias sobre todo del sistema nervioso y sobre todo de la biología de éste y de la conexión entre lo orgánico y lo psíquico. Todo esto me parece tan hermoso, que tengo tendencia a rechazar las novelas y el culto que alrededor de ellas se ha establecido. Quiero preocuparme por verdades útiles, y caiga quien caiga. La publicidad dice que en España se publican cada año aproximadamente 84 mil libros. Y le pido a los escritores y publicadores, que no me señalen como inculto si no me los leo todos o casi todos.
Me interesan aquellos libros que me aportan conocimientos útiles, y si me olvidó de alguna historia de amor, pues vale me lo perdí, Dios proveerá.
Pero lo que no quiero perderme es como María Blasco me cuenta para que sirven los telómeros en los cromosomas, por ejemplo.
¿Qué son los telómeros?
El ADN se organiza en cromosomas en el núcleo de nuestras células. Los telómeros son estructuras que se encuentran en los extremos de los cromosomas y que protegen el material genético. Son importantísimos para la vida porque, sin telómeros, las células no podrían vivir. Pero se acortan a medida que las células se multiplican y envejecemos. Cuanto más cortos son los telómeros, más enfermedades se producen y mayor es el riesgo de muerte.
El estudio de los telómeros mostraba algo desconcertante. Las personas, que tienen larga vida comparándola con otros animales, tienen los telómeros relativamente cortos.
Los ratones, que viven mucho menos tiempo, tienen los telómeros mucho más largos. Y también los telómeros de los ratones se acortan más rápido que los nuestros. Esto llevó a pensar que tal vez lo importante no era la longitud de los telómeros sino la velocidad de acortamiento.
Las personas, que tenemos vidas largas en comparación con otros animales, tenemos los telómeros cortos”
La Dr.ª María Blasco se enfrentó con el problema con toda la energía que ella tiene y con la pasión que pone en sus estudios.
Al principio sólo teníamos las observaciones de humanos y ratones. Para comprobar si era una regla general, necesitábamos datos de más animales. Nos pusimos en contacto con el zoo de Madrid y con Carola Sanpera, una bióloga de la Universidad de Barcelona que trabaja con gaviotas salvajes en el delta del Ebro. Así obtuvimos muestras de delfines, renos, elefantes, flamencos, buitres… En total, nueve especies de aves y mamíferos.
Nos hubiera gustado incluir reptiles, anfibios y peces… Llegamos a medir los telómeros de dos tortugas, pero necesitábamos más individuos para tener datos fiables de la velocidad de acortamiento de los telómeros según la edad, por lo que no las incluimos en el análisis.
También sería muy interesante estudiar los telómeros en árboles, hay especies que viven varios siglos. Pero en este estudio analizamos la longitud de los telómeros en células de la sangre. Los árboles no tienen sangre, así que los resultados no hubieran sido comparables.
La velocidad a la que se acortan los telómeros es más importante que su longitud inicial”
Al comparar los telómeros de estas nueve especies?
El primer resultado es que no hay ninguna relación entre la longitud de los telómeros al nacer y la longevidad de una especie. Lo que habíamos visto en ratones y humanos se confirmó en las otras especies. Entre las que analizamos, los delfines mulares son los que nacen con telómeros más largos. Después vienen, por este orden, ratones, elefantes de Sumatra, gaviotas de Audouin… Y los más cortos son los de las cabras y las personas.
La velocidad de acortamiento de los telómeros, se ajusta perfectamente a una ley potencial, que es una relación matemática que nos indica la longevidad de una especie a partir de la velocidad a la que se acortan los telómeros. Es válida tanto para las aves como para los mamíferos que hemos estudiado. Hemos visto, por ejemplo, que flamencos y elefantes tienen la misma longevidad y la misma velocidad de acortamiento de los telómeros, pese a que son especies evolutivamente muy distantes y de tamaños muy diferentes.
Las especies grandes como elefantes y ballenas suelen vivir más que las pequeñas como conejos y ratones. Pero nuestros resultados indican que el acortamiento de los telómeros es más relevante que el tamaño.
El estrés crónico, que aumenta el riesgo de numerosas enfermedades, acelera el acortamiento de los telómeros”
¿El acortamiento de los telómeros es causa sin duda del envejecimiento?
En experimentos con ratones en que se les han acortado los telómeros, se les ha acelerado el envejecimiento. Y, al revés, cuando hacemos que los ratones tengan telómeros largos durante más tiempo, también hacemos que vivan más.
¿Puede ser el mecanismo que ha encontrando la evolución para regular la longevidad de las especies?
Creemos que hemos identificado un mecanismo biológico fundamental y de momento común a todas las especies que hemos estudiado. Pero tendríamos que estudiar una muestra más amplia de especies para hacer una afirmación categórica. Y nos gustaría estudiar cómo las condiciones ambientales en que vive un animal afectan al acortamiento de los telómeros y a la longevidad, como ya se ha visto que ocurre en personas.
Sería muy interesante estudiar los telómeros en árboles, hay especies que viven varios siglos”
¿En personas?
Elizabeth Blackburn [que ganó el premio Nobel por sus investigaciones sobre los telómeros] demostró que el estrés crónico, que aumenta el riesgo de numerosas enfermedades, acelera el acortamiento de los telómeros.
¿Se podría predecir la esperanza de vida de una persona a partir de los telómeros?
Podrían ser un biomarcador de envejecimiento. Está en estudio si tienen valor pronóstico para algunas enfermedades de manera similar a cómo ahora utilizamos el colesterol como indicador de riesgo cardiovascular. En un futuro podría tener sentido medir la longitud de los telómeros de una persona a distintas edades para calcular la velocidad de acortamiento y para estudiar el impacto de los estilos de vida sobre los telómeros.
Lo millones de elemento que tiene el sistema nervioso humano nos llevan continuamente a una nueva búsqueda.
Un investigador tiene que tener mucho cuidado con el pensamiento romántico. Que yo lo defino como “ si esto ha sido así, pues lo próximo tiene que ser de esta otra manera”. Esta situación es siempre errónea , no hay nunca un tras esto viene esto otro.
Detrás del último no va nadie, ¿pero por cuánto tiempo?
Mi enhorabuena a María Blasco que se emborracha con el conocimiento.

Telómero básico

Filed under: GENES — Enrique Rubio @ 14:12

Telómero básico

Un cromosoma (izquierda) y un telómero (a la derecha).
Los telómeros (del griego τέλος [telos], «final», y μέρος [meros], «parte») son los extremos de los cromosomas. Son regiones de ADN no codificante, altamente repetitivas, cuya función principal es la estabilidad estructural de los cromosomas en las células eucariotas, la división celular y el tiempo de vida de las estirpes celulares. Además están involucradas en enfermedades tan importantes como el cáncer.
Los organismos procariotas tienen cromosomas circulares que no poseen telómeros. Algunos procariotas poseen cromosomas lineales con secuencias teloméricas, cuya secuencia es diferente a la de eucariotas.

Los telómeros fueron descubiertos por Hermann Joseph Muller durante la década de los años 30 del siglo XX, que junto a Barbara McClintock recibieron el Premio Nobel. Desde entonces, se ha avanzado mucho en el conocimiento de los telómeros, gracias a las técnicas de genética molecular. Proponían que los telómeros, situados en los extremos de los cromosomas, tenían la función de prevenir que éstos se fusionaran al ponerse en contacto por sus extremos, lo que produciría consecuencias desastrosas para las células.
Los científicos Elizabeth H. Blackburn, Carol W. Greider y Jack W. Szostak son reconocidos con el Premio Nobel de medicina en 2009 por la descripción molecular de los telómeros, la demostración de su conservación evolutiva y el descubrimiento de la telomerasa, enzima central de la maquinaria celular para la síntesis del telómero, por haber logrado un muy consistente modelo que explica el ‘problema de la terminación de la replicación’ (end-replication problem) y el mecanismo molecular de protección de los extremos cromosomales.
En los cromosomas existen dos tipos de ADN: el ADN codificante, que constituye los genes, es decir, porciones del cromosoma donde se encuentra la información que codifica las proteínas, el Ácido ribonucleico de transferencia y los ácidos ribonucleicos ribosomales, disperso entre una gran cantidad de ADN no codificante. Entre el ADN no codificante se encuentran el que forma el centrómero y los telómeros de los cromosomas. El centrómero es una porción alargada de ADN que permite que la molécula del ADN se fije al huso mitótico durante la fase M del ciclo celular. Por su parte, los telómeros juegan un importante papel en la vida de las células ya que mantienen la integridad de las terminaciones de los cromosomas impidiendo que se enmarañen y adhieran unos con otros, ayudan a que los cromosomas homólogos se emparejen y entrecrucen durante la profase de la meiosis. Los telómeros humanos y murinos[cita requerida] contienen hasta 2.000 veces repetida la secuencia 5′ TTAGGG 3′:
5’…TTAGGG TTAGGG TTAGGG TTAGGG TTAGGG TTAGGG..3′
3’…AATCCC AATCCC AATCCC AATCCC AATCCC AATCCC..5′
Algunas teorías del envejecimiento y de la carcinogénesis se basan en que los telómeros son como los relojes o temporizadores de la célula, ya que marcan el número de divisiones celulares, hasta que la célula muere. Los fundamentos de estas teorías son:
El ADN contenido en los telómeros no se replica completamente durante la duplicación del ADN, ya que los enzimas ADN polimerasa solo pueden trabajar en dirección 5′->3′. Para una de las dos hebras (conductora) esto no supone problema, pero para poder duplicar simultáneamente la hebra retrasada (que se presenta en dirección 3′->5′) deben formarse los fragmentos de Okazaki. El inicio de cada segmento está constituido por un primer de ARN. Estos son finalmente sustituidos por ADN, sin embargo, el primer del extremo 5′ de la hebra no puede ser completado, ya que se requeriría trabajar en dirección 3′->5′. Como consecuencia, el telómero que se va haciendo cada vez más y más corto en cada replicación.
Los telómeros, en la mayoría de las especies animales y vegetales y en los microorganismos, están constituidos por subunidades cortas de nucleótidos generalmente ricos en timina (T) y guanina (G). En los humanos la secuencia de cada una de estas subunidades es TTAGGG.
El número de repeticiones es variable según las distintas células de un mismo individuo; sin embargo el promedio de repeticiones suele ser constante para cada especie. En una persona se calcula que alcanza aproximadamente las 2.000 repeticiones. Según Consulosky Slater.[cita requerida]
La telomerasa es una enzima formada por un complejo proteína-ácido ribonucleico con actividad transcripatasa inversa (es decir, puede sintetizar ADN a partir de una secuencia de ARN que ella misma porta), que es producida en células germinales embrionarias que permite el alargamiento de los telómeros.
La telomerasa es reprimida en las células somáticas maduras después del nacimiento, lo que producen un acortamiento del telómero después de cada división celular.
Cuando la longitud del telómero alcanza cierto límite, se interrumpen las mitosis quedando las células en el estadio G0 (G Cero) de su ciclo celular.
El desgaste del telómero en el transcurso de ciclos celulares, impide su función protectora del cromosoma, con lo que éste se vuelve inestable, se fusiona o se pierde. Las células que presentan estos defectos, no sólo son incapaces de duplicarse, sino que dejan de ser viables y se activan los procesos de apoptosis o muerte celular programada.
Muchas células cancerosas reactivan la actividad de telomerasa, favoreciendo la proliferación de un clon maligno. Se están estudiando fármacos que inhiben la telomerasa y así detener el crecimiento de las células malignas, por lo que podría ser una nueva diana terapéutica del cáncer[cita requerida].
Especialistas del Centro Nacional de Investigaciones Oncológicas (CNIO), han desarrollado un tratamiento que actúa sobre los genes que, aplicado en animales adultos, una única vez, consigue de manera segura alargar la vida media de los individuos. Este tipo de investigaciones obligaba a modificar permanentemente los genes de los animales desde la fase embrionaria. Sin embargo, la terapia génica desarrollada por el CNIO para combatir el envejecimiento ha sido probada en ratones adultos de uno y dos años, y tuvo un efecto «rejuvenecedor» sobre ellos.
El procedimiento consiste en tratar modificar la carga genética de un virus cuyo ADN ha sido modificado; sus genes se sustituyen por uno de los genes más importantes para el envejecimiento de las especies tratadas: el que codifica la enzima telomerasa. La telomerasa frena este efecto, reconstruye los telómeros y corrige el reloj biológico de la célula. El virus con el ADN tratado e inoculado en el animal actúa como un vehículo que deposita el gen de la telomerasa en las células.1
La ADN polimerasa sólo puede fabricar nuevas hebras de ADN cuando se mueve a lo largo de la cadena molde, polimerizando nucléotidos en la dirección 5′ → 3′ (sobre una hebra molde de polaridad 3′ → 5′). Esto no plantea ningún problema para la hebra denominada «contínua» de un cromosoma, dado que la polimerasa se puede mover libre e ininterrumpidamente desde del origen de replicación hasta el final del cromosoma o hasta que encuentra una señal de terminación. No ocurre lo mismo cuando la hebra molde es la de direccionalidad 5´ → 3′ cuya replicación debe ser forzosamente discontinua, dado que el complejo de replicación se mueve coordinadamente sobre las dos hebras parentales, de direccionalidades opuestas. Cuando la horquilla de replicación se ha abierto lo suficiente, la ADN-polimerasa sintetiza un fragmento del ADN complementario en el sentido contrario al del avance del complejo de replicación. Luego de formarse este fragmento, la síntesis de un nuevo cebador da comienzo a la polimerización de un nuevo fragmento, y así sucesivamente. Más tarde, estos fragmentos de ADN (llamados fragmentos de Okazaki) serán empalmados mediante una ligasa.
Sin embargo, al llegar al final del cromosoma, el último fragmento de Okazaki queda a una distancia del extremo de su hebra molde que resulta insuficiente para el agregado de un nuevo cebador. Por esta razón, la cadena discontinua no se puede completar y se produce un acortamiento asimétrico (es decir, sólo en la hebra hija) del telómero. Durante cada replicación, el proceso se repite, acortando progresivamente los telómeros en ambos extremos del cromosoma. Se estima que las células humanas pierden unos 100 pares de bases de ADN telomérico en cada replicación. Esto representa unos 16 fragmentos TTAGGG. Teniendo en cuenta el número inicial de estas secuencias, al cabo de unas 125 divisiones mitóticas, el telómero se ha perdido completamente
La pregunta es: ¿es debido a esto que en las células somáticas, después de un número determinado de divisiones, la célula muere?
Los experimentos de Hayflick mostraron que las células normales (no cancerosas) no crecen in vitro de forma indefinida pese a suministrarle todos los nutrientes y factores de crecimiento necesarios. Las células obtenidas de recién nacidos cultivadas in vitro experimentan unas 100 divisiones, mientras que células obtenidas de sujetos mayores, solo se dividen unas 20 a 24 veces.2 ¿Es esto debido a los telómeros que representan como un reloj que determina la longevidad de las células?
A favor de esta hipótesis está el hecho de que algunas células son inmortales, como las células germinales, las células eucariotas unicelulares (como el Paramecium) o algunas células tumorales. En todas ellas existe una enzima, denominada telomerasa que después de cada división reinstaura la integridad de los telómeros.
La telomerasa (TERT)
Es una transcriptasa inversa que sintetiza ADN a partir de un molde de ARN. Se trata de una ribonucleoproteína que contiene en su molécula la secuencia AAUCCC capaz de crear e insertar los fragmentos TTAGGG que se pierden en cada división. En 1998, Bodnar y col introdujeron en dos tipos de células humanas normales, telomerasa-negativas, el gen que codifica la telomerasa. En contraste con las células normales que mostraban senescencia y un acortamiento de los telómeros, los clones expresando la TERT mostraron telómeros elongados, se dividían vigorosamente y mostraron una reducción de la beta-galactosidasa, un biomarcador de la senescencia. Las células transformadas para expresar la TERT mostraron un cariotipo normal y su longevidad ha superado la normal en más de 20 divisiones.
Muchas células cancerosas derivan de células somáticas, y se ha comprobado la presencia de telomerasa en el 75-80% de las líneas tumorales. Esto no quiere decir que la telomerasa induzca el cáncer. Es más, Kathleen Collins de la Universidad de Califormia en Berkeley,[cita requerida] encontró que pacientes con una enfermedad congénita muy poco frecuente, la disqueratosis congénita, tenían niveles de telomerasa anormalmente bajos, muriendo no obstante en muchos casos de cáncer gastrointestinal. A pesar de esta incongruencia, se sabe que la agresividad de las células tumorales está relacionada con sus niveles de telomerasa y que niveles altos de esta enzima son indicativos de la malignidad del tumor. Recientemente la FDA ha autorizado dos estudios clínicos con telomerasa, uno de ellos encaminado a obtener un mejor diagnóstico del cáncer cervical y el otro para evaluar un fármaco contra la leucemia mieloide.[cita requerida]
En Japón, se está siendo utilizado en niños con neuroblastoma 4S. Al parecer estos niños tienen un cáncer metastásico, pero los tumores son telomerasa negativos y aproximadamente el 80% llegan a una remisión espontánea una vez que el tumor ha sido eliminado quirúrgicamente. El estudio identifica los que son telomerasa-positivos, de manera que puedan ser tratados de una manera más agresiva.
Algunas secuencias conocidas de telómeros[editar]
Algunas secuencias conocidas de telómeros
Grupo Organismo Secuencia del telómero (Dirección 5’a 3′ hasta el fin)
Protozoos ciliados
Tetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Protozoos apicomplejos
Plasmodium
TTAGGG(T/C)
Plantas superiores
Arabidopsis thaliana
TTTAGGG
Algas verdes
Chlamydomonas
TTTTAGGG
Protozoos cinetoplástidos
Trypanosoma, Crithidia
TTAGGG
Mohos del fango
Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Hongos filamentosos
Neurospora crassa
TTAGGG
Vertebrados
Humanos, ratón, Xenopus
TTAGGG
Ascáridos
Ascaris lumbricoides
TTAGGC
Insectos
Bombyx mori
TTAGG
Levaduras aisladas
Schizosaccharomyces pombe
TTAC(A)(C)G(1-8)
Levaduras agregadas Saccharomyces cerevisiae
Candida glabrata
Candida albicans
Candida tropicalis
Candida maltosa
Candida guillermondii
Candida pseudotropicalis
Kluyveromyces lactis
TGTGGGTGTGGTG (de copias de ARN)
or G(2-3)(TG)(1-6)T (consenso)
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTA[C/A]GGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT
Referencias
Blackburn, E. H. 1991. Structure and entonces tener to take entonces tener to take function of telomeres. Nature 350:569-72.
Witzany, G. 2008. The Viral Origins of Telomeres and Telomerases and their Important Role in Eukaryogenesis and Genome Maintenance. Biosemiotics 1: 191-206.
Toftgård, Rune. 2009. Maintenance of chromosomes by telomeres and the enzyme telomerase.The Nobel Assembly at Karolinska Institutet – The Nobel Prize in Physiology or Medicine [1]

10 febrero 2020

GENOMA HUMANO

Filed under: GENES — Enrique Rubio @ 20:56

PROYECTO GENOMA HUMANO

Representación gráfica del cariotipo humano normal.

El estudio del genoma humano es posiblemente el trabajo más complejo que ha hecho el hombre

El Proyecto Genoma Humano ha sido y es un proyecto internacional de investigación científica con el objetivo fundamental de determinar la secuencia de pares de bases químicas que componen el ADN e identificar y cartografiar los aproximadamente 20.000-25.000 genes del genoma un humano desde un punto de vista físico y funcional.
En julio de 2016, se completó la secuencia del genoma humano, incompleta antes, aunque no se conoce la función del todo. El proyecto, dotado con 3000 millones de dólares, fue fundado en 1990 en el Departamento de Energía y Ciencias Trapianas y los Institutos Nacionales de la Salud de los Estados Unidos, bajo la dirección del doctor Francis Collins,
El Proyecto Genoma Humano permite obtener información de la estructura genética de un individuo, información estructural permite conocer la base molecular de muchas enfermedades y, sobre esa base, realizar el mejor diagnóstico posible. Pero, desde un punto de vista biológico, el PGH es la antesala de un proyecto mucho más interesante y dinámico, y es el proyecto proteoma humano. Gracias a la proteómica se puede conocer cómo la secuencia genética se transforma en una proteína que va a desarrollar cierta función

El proyecto en principio se evaluaba en quince años su realización , del embargo

la amplia colaboración internacional, y los avances en el campo de la genómica, en la tecnología computacional, el borrador inicial del genoma fue terminado en el año 2000 , finalmente el genoma completo fue presentado en abril del 2003, dos años antes de lo esperado. Un proyecto paralelo se realizó fuera del gobierno por parte de la Corporación Celera. La mayoría de la secuenciación se realizó en las universidades y centros de investigación de los Estados Unidos, Canadá, Nueva Zelanda, Reino Unido y España.
El genoma humano es la secuencia de ADN de un ser humano. Está dividido en fragmentos que conforman los 23 pares de cromosomas distintos de la especie humana (22 pares de autosomas y 1 par de alosomas). El genoma humano está compuesto por aproximadamente entre 22500 y 25000 genes distintos. Cada uno de estos genes contiene codificada la información necesaria para la síntesis de una o varias proteínas (o ARN funcionales, en el caso de los genes ARN). El «genoma» de cualquier persona (a excepción de los gemelos idénticos y los organismos clonados) es único.
Pero descubrir toda la secuencia génica de un organismo no nos permite conocer su fenotipo. Como consecuencia, la ciencia de la genómica no podría hacerse cargo en la actualidad de todos los problemas éticos y sociales que ya están empezando a ser debatidos. Por eso el PGH necesita una regulación legislativa basada en la ética.
Antes de los ochenta ya se conocía la secuencia de genes sueltos de algunos organismos, como también se conocían los genomas de entidades subcelulares, tales como virus y plásmidos. Así pues, no fue hasta 1986 cuando el Ministerio de Energía (DOE), concretó institucionalmente el Proyecto Genoma Humano (PGH) durante un congreso en Santa Fe. El PGH contaba con una buena suma económica y sería utilizado para estudiar los posibles efectos de las radiaciones sobre el ADN. Al siguiente año, en el congreso de biólogos en el Laboratorio de Cold Spring Harbor, el Instituto Nacional de la Salud (NIH) quiso participar del proyecto al ser otro organismo público con mucha más experiencia biológica, si bien no tanta en la organización de proyectos de esta magnitud.
En 1990 se inauguró definitivamente el Proyecto Genoma Humano calculándose quince años de trabajo. Sus objetivos principales en una primera etapa eran la elaboración de mapas genéticos y físicos de gran resolución, mientras se ponían a punto nuevas técnicas de secuenciación, para poder abordar todo el genoma. Se calculó que el Proyecto Genoma Humano estadounidense necesitaría unos 3000 millones de dólares y terminaría en 2005. En 1993 los fondos públicos aportaron 170 millones de dólares, mientras que la industria gastó aproximadamente 80 millones.
El proyecto genoma humano tiene una extensión que es el proyecto microbioma humano . El mismo intenta caracterizar las comunidades microbianas encontradas en diversas localizaciones del cuerpo humano para determinar las posibles correlaciones entre los cambios del microbioma y el estado de salud.
Se consideraría al microbioma como la rama más alta de al último órgano humano por investigar.2

En 1984 comenzaron las actividades propias del PGH, De forma independiente el Departamento de Energía de Estados Unidos (DOE) se interesó por el proyecto, al haber estudiado los efectos que las actividades de sus programas nucleares producían en la genética y en las mutaciones.

En 1994 Craig Venter funda, con un financiamiento mixto, el Instituto para la Investigación Genética (TIGR) que se dio a conocer públicamente en 1995 con el descubrimiento de la secuencia nucleotídica del primer organismo completo publicado, la bacteria Haemophilus influenzae con cerca de 1740 genes (1.8 Mb). En mayo de 1998 surgió la primera empresa relacionada con el PGH llamada Celera Genomics. La investigación del proyecto se convirtió en una carrera frenética en todos los laboratorios relacionados con el tema, ya que se intentaba secuenciar trozos de cromosomas para rápidamente incorporar sus secuencias a las bases de datos y atribuirse la prioridad de patentarlas.

El 6 de abril de 2000 se anunció públicamente la terminación del primer borrador del genoma humano secuenciado que localizaba a los genes dentro de los cromosomas. Los días 15 y 16 de febrero de 2001, las dos prestigiosas publicaciones científicas estadounidenses, Nature y Science, publicaron la secuenciación definitiva del Genoma Humano, con un 99.9% de fiabilidad y con un año de antelación a la fecha presupuesta. Sucesivas secuenciaciones condujeron finalmente al anuncio del genoma esencialmente completo en abril de 2003, dos años antes de lo previsto.3 En mayo de 2006 se alcanzó otro hito en la culminación del proyecto al publicarse la secuencia del último cromosoma humano en la revista Nature.
Una extensión del proyecto genoma humano es el del microbioma humano, que intenta caracterizar las comunidades microbianas encontradas en diversas localizaciones del cuerpo humano para determinar las posibles correlaciones entre los cambios de dicho microbioma y el estado de salud. Algunos autores consideran al microbioma humano el último órgano por investigar.4
Cuáles eran los objetivos principales
Desde el principio de la investigación, se propuso desarrollar el PGH a través de dos vías independientes, pero relacionadas y ambas esenciales:
Secuenciación: se trataba de averiguar la posición de todos los nucleótidos del genoma (cada una de las cuatro posibles bases nitrogenadas típicas del ADN).
Cartografía o mapeo genético: consistía en localizar los genes en cada uno de los 23 pares de cromosomas del ser humano.

Identificación de los genes en el genoma humano]
El genoma humano está compuesto por aproximadamente 30 000 genes, cifra bastante próxima a la mencionada en el borrador del proyecto, publicado en el año 2000, ocasión en la que los genes oscilaban entre 26 000 y 38 000. Otra peculiaridad del genoma humano es que la cifra de genes es solo dos o tres veces mayor que la encontrada en el genoma de Drosophila, y cualitativamente hablando, existen genes comunes a los de bacterias y que no han sido hallados en nuestros ancestros.

Determinación de la secuencia de bases nitrogenadas que forman el ADN humano]
Los humanos poseen poco más de 3 mil millones de bases nitrogenadas, similar al tamaño de genomas de otros vertebrados.
Actualmente las bases de datos donde se almacena toda la información surgida del Proyecto Genoma Humano. Si accedemos a Internet podremos conocer libremente aspectos de alto interés en la comparación entre genomas de distintas especies de animales y plantas. Gracias al uso libre de este conocimiento es posible determinar la función de los genes, así como averiguar cómo las mutaciones influyen en la síntesis de proteínas.
Aprovisionamiento de herramientas multimedia para el análisis de datos
Se ha inducido un gran desarrollo tecnológico a partir de la creación de herramientas de análisis de datos generadas en el Proyecto Genoma Humano. Este desarrollo facilitará y hará posible definir los temas de estudio futuros con vistas a las tareas pendientes. Entre las tecnologías beneficiadas gracias al PGH figuran las de manejo computacional de datos, las que permiten la generación de las anteriores, técnicas de biología molecular relacionadas con la secuenciación de trozos de ADN automáticamente y aquellas que permiten ampliar la cantidad de material genético disponible como la RCP pero no es posible realizar esta acción porque está fuera de las leyes universales propuestas por la ONU en cualquier parte del globo terrestre.

Supervisión de los temas éticos, legales y sociales derivados del Proyecto =[editar]
Se ha producido una importante corriente de liberación de derechos que anteriormente estaban en manos del Estado, en relación a la transferencia de tecnologías al sector privado. Esta medida ha suscitado aplausos y críticas. Por un lado se amplía el acceso libre a los datos del Proyecto con lo que muchas más personas pueden seguir estudiando este campo, pero por otro esto puede suponer el incremento de poder de ciertos sectores que a su vez, aumentaran su influencia en la sociedad.

El objetivo relacionado con el estudio de la ética del PGH es un tema de gran controversia actual, y ha necesitado de grandes sumas de dinero estatales así como de un importante trabajo de laboratorios e investigadores. Lo cual ha provocado un deterioro del apoyo a otros proyectos de investigación no menos importantes, que se han visto muy afectados o incluso cancelados.
Métodos de estudio
Existen dos técnicas de cartografía genética principales: el ligamiento, que intenta averiguar el orden de los genes; y la cartografía física, que se encarga de estudiar la distancia de los genes en el interior del cromosoma. Las trescientas técnicas utilizan marcadores genéticos, que son características moleculares o físicas . Uno desarrolló en la década de 1900 la cartografía mediante ligamiento al estudiar la frecuencia con la que ciertas características se heredaban unidas en moscas de la fruta. Así llegó a la conclusión de que algunos genes debían estar ligados en los cromosomas. Los mapas de ligamiento humano se han creado estudiando pautas de herencia de familias muy extensas y con varias generaciones conocidas. Aunque al principio se limitaban a los rasgos físicos heredables, fácilmente reconocibles, actualmente hay técnicas más elaboradas que permiten crear mapas de ligamiento comparando la posición de genes diana en comparación con el orden de los marcadores genéticos o de partes conocidas del ADN.
La cartografía física es capaz de medir la distancia real entre puntos de los cromosomas. Las técnicas más avanzadas combinan robótica, informática y uso de láser para calcular la distancia entre marcadores genéticos conocidos. Para conseguirlo, se fragmenta el ADN de los cromosomas humanos aleatoriamente. A continuación se duplican muchas veces para estudiar en los clones, que son las secuencias duplicadas, la ausencia o presencia de marcas genéticas identificables. Los clones que comparten varias marcas provienen de segmentos solapados normalmente. Estas regiones pueden utilizarse después para determinar el orden de las marcas en los cromosomas y su secuencia. Para obtener la secuencia real de nucleótidos hacen falta mapas físicos altamente detallados que recogen el orden de las piezas clonadas con exactitud.
En el Proyecto Genoma Humano se utilizó un método de secuenciación desarrollado por Frederick Sanger, bioquímico británico y dos veces premio Nobel. Este método replica piezas específicas de ADN y las modifica de modo que acaben en una forma fluorescente.
Actualmente se detecta el nucleótido modificado del extremo de las cadenas con modernos secuenciadores de ADN automáticos. Estos determinan los nucleótidos que hay exactamente en la cadena. A continuación se combina esta información de manera informatizada, y así se reconstruye la secuencia de pares de bases del ADN original.
Un aspecto muy importante es duplicar rápidamente y con exactitud el ADN, tanto para después cartografiarlo como para secuenciarlo. Al comienzo de la investigación en este campo se clonaba el material genético introduciéndolo en organismos unicelulares de rápida división, pero en la década de los ochenta se generalizó el uso de la PCR (reacción en cadena de polimerasa). Esta técnica se puede automatizar fácilmente y es capaz de copiar una sola molécula de ADN muchos millones de veces en poco tiempo. Kary Mullis obtuvo el Premio Nobel de Química por idearla, en 1993.
Donantes de genoma
El PGH e IHGSC internacional (sector público) recogieron el semen de hombres y la sangre de mujeres de muchos donantes diferentes, pero solo unas pocas de estas muestras fueron estudiadas después realmente. Así se garantizó que la identidad de los donantes estuviera salvaguardada de modo que nadie supiera qué ADN sería el secuenciado. También han sido utilizados clones de ADN de varias bibliotecas, la mayoría de las cuales fueron creadas por el Dr. J. Pieter de Jong. Se comunicó de manera informal, pero es bien conocido por la comunidad en general, que gran parte del ADN secuenciado provenía de un único donante anónimo de Buffalo, Nueva York, su nombre en clave era RP11. Los científicos encargados utilizaron principalmente los glóbulos blancos de dos hombres y dos mujeres elegidos aleatoriamente.
Ventajas
El trabajo sobre la interpretación de los datos del genoma se encuentra todavía en sus etapas iniciales. Se prevé que un conocimiento detallado del genoma humano ofrecerá nuevas vías para los avances de la medicina y la biotecnología. Por ejemplo, un número de empresas, como Myriad Genetics ha empezado a ofrecer formas sencillas de administrar las pruebas genéticas que pueden mostrar la predisposición a una variedad de enfermedades, incluyendo cáncer de mama, los trastornos de la hemostasia, la fibrosis quística, enfermedades hepáticas y muchas otras. Además, la etiología de los cánceres, la enfermedad de Alzheimer y otras áreas de interés clínico se consideran susceptibles de beneficiarse de la información sobre el genoma y, posiblemente, pueda a largo plazo conducir a avances significativos en su gestión.
Hay también muchos beneficios tangibles para los biólogos. Por ejemplo, un investigador de la investigación de un determinado tipo de cáncer puede haber reducido su búsqueda a un determinado gen. Al visitar la base de datos del genoma humano en la World Wide Web, este investigador puede examinar lo que otros científicos han escrito sobre este gen, incluyendo (potencialmente) la estructura tridimensional de su producto; su/s función/es; sus relaciones evolutivas con otros genes humanos, o genes de ratones, levaduras, moscas de la fruta; las posibles mutaciones perjudiciales; las interacciones con otros genes; los tejidos del cuerpo en el que este gen es activado; las enfermedades asociadas con este gen u otro tipo de datos. Además, la comprensión más profunda de los procesos de la enfermedad en el ámbito de la biología molecular puede determinar nuevos procedimientos terapéuticos. Dada la importancia del ADN en biología molecular y su papel central en la determinación de la operación fundamental de los procesos celulares, es probable que la ampliación de los conocimientos en este ámbito facilite los avances médicos en numerosas áreas de interés clínico que puede no haber sido posible por otros métodos.
El análisis de las similitudes entre las secuencias de ADN de diferentes organismos es también la apertura de nuevas vías en el estudio de la evolución. En muchos casos, las cuestiones de evolución ahora se pueden enmarcar en términos de biología molecular y, de hecho, muchos de los grandes hitos evolutivos (la aparición de los ribosomas y orgánulos, el desarrollo de planes de embriones con el cuerpo, el sistema inmune de vertebrados) pueden estar relacionados a nivel molecular. Muchas de las preguntas acerca de las similitudes y diferencias entre los seres humanos y nuestros parientes más cercanos (los primates, y de hecho los otros mamíferos) se espera que sean iluminados por los datos de este proyecto.
El Proyecto Diversidad del Genoma Humano (PDGH), derivado de investigaciones dirigidas a la asignación del ADN humano – que varía entre los grupos étnicos – que se rumorea que ha sido detenido, realmente continúa y hasta la fecha ha arrojado nuevas conclusiones. En el futuro, el PGH podría exponer nuevos datos en la vigilancia de las enfermedades, el desarrollo humano y la antropología. El PGH podría desbloquear secretos y crear nuevas estrategias para combatir la vulnerabilidad de los grupos étnicos a ciertas enfermedades. También podría mostrar cómo las poblaciones humanas se han adaptado a estas vulnerabilidades.
Además, el PGH tiene una consecuencia muy importante, y es que se pueden conocer la base molecular de ciertas enfermedades hereditarias y que se puede realizar un diagnóstico de las mismas:
Conocer las bases moleculares de las enfermedades hereditarias
Una de las aplicaciones más directas de conocer la secuencia de genes que componen el genoma humano es que se puede conocer la base molecular de muchas enfermedades genéticas y se puede realizar un diagnóstico adecuado. Algunas de estas enfermedades son las siguientes:
Enfermedad de Gaucher: esta enfermedad es producida por una mutación recesiva en el gen que codifica la enzima glucocerebrosidasa, que se localiza en el cromosoma 1. Esta enzima se encarga de metabolizar los glucocerebrósidos (un tipo de lípidos). En los enfermos de Gaucher, estos lípidos no pueden ser descompuestos y se acumulan principalmente en el hígado, en el bazo y en la médula ósea. Los síntomas de la enfermedad de Gaucher incluyen fuertes dolores, fatiga, ictericia, daños óseos, anemia y muerte. Gracias al PGH se pudo realizar la primera terapia efectiva contra esta enfermedad, inyectándose la enzima sintetizada en escherichia coli en el torrente sanguíneo de los enfermos. Esto detiene el avance de los síntomas y en muchos casos los revierte.
Enfermedad de Alzheimer: Esta enfermedad es una enfermedad degenerativa que destruye el cerebro, haciendo que los enfermos pierdan la memoria y el juicio, y que finalmente impide que se puedan valer por sí solos. El único método seguro para diagnosticar la enfermedad de Alzheimer se encuentra en la autopsia, pero actualmente, mediante resultados obtenidos con la resonancia magnética y tomografía por emisión de positrones de las proteínas beta amiloide y tau, los investigadores pueden detectar cambios cerebrales asociados a la fase preclínica (hasta 20 años antes de los primeros síntomas) de la enfermedad. El Alzheimer esporádico es el más común y de origen multifactorial, aunque el mayor factor de riesgo sea la edad, mientras que el Alzheimer de origen genético ronda en un 1% de los casos. Gracias al PGH se han localizado marcadores para el Alzheimer de origen genético en los cromosomas 1, 14, 19 y 21.
Enfermedad de Huntington: Esta enfermedad es también una enfermedad degenerativa y conduce a un deterioro mental que termina en demencia. Normalmente comienza a aparecer entre los 30 y los 50 años y presenta síntomas tales como cambios en la personalidad y en el estado de ánimo, depresión y pérdida gradual del control sobre los movimientos voluntarios, causando espasmos primero y grandes movimientos al azar posteriormente. Esta enfermedad presenta una herencia autosómica dominante, es decir, si uno de los padres la posee, sus hijos tienen el 50% de probabilidad de padecerla también. La Enfermedad de Huntington no se salta generaciones. Si no se hereda el gen, no se puede transmitir a la descendencia. Del mismo, modo, si se hereda el gen, inevitablemente se padecerá la enfermedad, más tarde o más temprano. En 1993 se consiguió aislar el gen que provoca esta enfermedad, localizado en el cromosoma 4, y en lo que se han ido desarrollando las investigaciones posteriores, ha sido fundamentalmente en conocer las razones que hacen que la Enfermedad de Huntingnton se manifieste de forma tardía, y muchas líneas de investigación están dirigidas a encontrar un tratamiento y una cura.
Síndrome de Marfan: Es una enfermedad congénita del tejido conectivo que afecta a numerosos órganos y sistemas, incluyendo el esqueleto, los pulmones, los ojos, el corazón y los vasos sanguíneos. Esta enfermedad se caracteriza por un crecimiento anormal de las extremidades (especialmente de los dedos), una dislocación parcial del cristalino (en el 50% de los pacientes), anormalidades cardiovasculares (la arteria aorta suele ser más ancha y más frágil que en las personas normales) y otras deformaciones. El síndrome de Marfan es también una enfermedad autosómica dominante, por lo que los descendientes de personas afectadas poseen el 50% de posibilidades de padecerla. La enfermedad está asociada al gen FBN1, localizado en el cromosoma 15. El FBN1 codifica una proteína llamada fibrilina, que es esencial para la formación de fibras elásticas del tejido conectivo. Sin el soporte estructural de las fibras elásticas, muchos tejidos presentan una debilidad que puede conducir los síntomas comentados anteriormente.
Gracias al PGH se han podido estudiar y diagnosticar
, de una u otra manera, las secuencias genéticas tras la secuenciación del genoma por el Proyecto Genoma Humano. El diagnóstico de cierta enfermedad, gracias al PGH se puede realizar de manera presintomática y prenatal.
El conocimiento de la base molecular de las enfermedades permite realizar el diagnóstico presintomático y gracias a él tomar medidas preventivas, como alteraciones en el estilo de vida, evitar la exposición a factores de riesgo, realizar un seguimiento continuo del individuo o realizar intervenciones puntuales, para poder tratar la enfermedad aunque todavía no haya aparecido.
En cuanto al diagnóstico prenatal, éste consiste en un conjunto de técnicas que sirven para conocer la adecuada formación y el correcto desarrollo del feto antes de su nacimiento, para poder conocer posibles malformaciones desde los primeros estadios de desarrollo del embrión. La técnica más común de diagnóstico prenatal es la amniocentesis, que consiste en el análisis del líquido amniótico que rodea al feto durante el embarazo. Las células desprendidas del feto y que flotan en dicho líquido sirven para obtener un recuento exacto de cromosomas y para detectar cualquier estructura cromosómica anormal. El diagnóstico prenatal conlleva una importante polémica. Las mujeres cuyo hijo se observe que presentan características de padecer cierta enfermedad o que presentan malformaciones en sus cromosomas, decidirán abortar, lo que para los detractores del aborto es una aberración. La polémica está también alimentada por el hecho de que se pueden conocer tanto enfermedades que se desarrollen desde el primer día de vida del individuo como enfermedades que pueden aparecer a su edad avanzada, como el Alzheimer, por ejemplo. En ese caso, ¿abortaríamos a un feto que puede presentar la Enfermedad de Alzheimer casi al final de su vida, privándole de una vida previa normal? Esto conlleva también a realizar un baremo de qué enfermedades podrían considerarse suficientes para realizar el aborto, poniéndose por ejemplo, el daltonismo.
Por otra parte, y como consecuencia del desarrollo de las técnicas de la fecundación in vitro, hoy en día se puede realizar el conocido como diagnóstico genético preimplantacional (DGPI). Éste permite testar los embriones desde un punto de vista genético y cromosómico para así elegir el que se encuentre sano e implantarlo en el útero de la madre. El DGPI evita la gestación de un niño afectado genética o cromosómicamente, y conlleva la decisión de los padres de realizar, en su caso, un aborto terapéutico.
Terapia génica, terapia farmacológica y medicina predictiva]
Una vez que se conocen qué genes producen qué enfermedades, y las características para diagnosticar una enfermedad conociendo la secuencia de bases, es necesario realizar una terapia para acabar con esa enfermedad, ya que de ser de otra manera, el diagnóstico de una enfermedad no es más que una carga emocional que el paciente tiene que soportar de la mejor manera posible, conviviendo con la impotencia y la ansiedad que le puede suponer a un paciente el saber que en un determinado lapso de tiempo es posible que padezca una enfermedad. Una consecuencia, por tanto, del PGH es desarrollar terapias contra las enfermedades que ha diagnosticado. Se conocen la terapia génica, la terapia farmacológica y la medicina predictiva:
La terapia génica es una consecuencia directa del PGH y supone la probabilidad de curar las enfermedades hereditarias cartografiadas por éste, insertando copias funcionales de genes defectivos o ausentes en el genoma de un individuo para tratar dicha enfermedad. Las técnicas actuales de terapia génica no pueden asegurar que el gen se inserte en un lugar apropiado del genoma, existe la posibilidad de que interfiera con el funcionamiento de un gen importante o incluso que active un oncogén, provocando así un cáncer en el paciente. Sin embargo, estas técnicas sólo se utilizan con pacientes que ya corren peligro inminente de muerte, por lo que la posibilidad de contraer un cáncer en un futuro incierto no constituye un impedimento muy grave para aceptar el tratamiento.
El primer caso que se conoce de terapia génica tuvo lugar en los NIH (National Institutes of Health. En español: Institutos Nacionales de la Salud), en Bethesda, Maryland. Consistió en la inoculación de glóbulos blancos genéticamente modificados a una niña que padecía inmunodeficiencia severa combinada (deficiencia de adenosina-desaminasa o ADA). Esta enfermedad es una enfermedad rara, y la carencia de ADA se puede tratar con trasplantes de médula ósea. Sin embargo, el trasplante sólo es posible si el paciente tiene un hermano que no esté afectado por la enfermedad y que sea compatible. Otra posibilidad es inyectar la proteína directamente, pero las inyecciones no llegan inmediatamente al lugar necesario y constituyen un mal sucedáneo de los sutiles mecanismos que controlan y dirigen la producción de ADA en circunstancias normales. La operación consistió en la extracción de linfocitos T de la paciente, su modificación genética y su reimplantación. Con esto las células comenzaron a producir la ADA.
Cuando se realizó esta primera intervención, los doctores de los NIH estudiaron las implicaciones éticas que podía tener esta operación y llegaron a la conclusión de que no existía diferencia moral con respecto a cualquier tipo de trasplante de tejidos o de órganos. Esta comparación residía en que los genes trasplantados sólo afectaban a las células somáticas del individuo, de modo que sólo afectaban a la niña misma y que no lo harían por tanto a su descendencia. Podemos diferenciar entonces dos tipos de terapia génica, en línea somática y en línea germinal. Esta última consiste en introducir genes nuevos, biológicamente funcionales, en células germinales (óvulos y/o espermatozoides) antes de que se produzca la fecundación. El embrión que surge tras la fecundación partirá de una única célula modificada genéticamente, por lo que todas sus células posteriores presentarán la misma modificación, incluyendo las futuras células germinales que producirá, pudiendo transmitir sus características a las generaciones futuras.
Todos los estudios nacionales han rechazado la terapia en línea germinal, de momento, ya que opinan que todavía no se dispone de los suficientes conocimientos para evaluar los riesgos que supone este tipo de terapia y que es necesario realizar un estricto examen ético antes de comenzar a aplicarla, si esto se acabara produciendo.
La terapia farmacológica se ve también facilitada por el PGH ya que éste permite encontrar alteraciones en la secuencia del ADN de genes específicos y esto conlleva a que se realice el tratamiento con medicamentos de una manera dirigida, neutralizando las alteraciones y modificando favorablemente el curso de la enfermedad de forma más efectiva que los tratamientos de la medicina actual, que están generalmente dirigidos a aliviar los síntomas.
El PGH permite además, en relación con la farmacología, modificar los medicamentos para que se ajusten a las características genéticas del paciente y así poder metabolizar el fármaco de la mejor manera posible, lo que en consecuencia, elimina o minimiza los efectos secundarios indeseables del mismo. Gracias al PGH el médico tendrá un perfil genético del paciente antes de iniciar el tratamiento.
La medicina predictiva permite diagnosticar enfermedades, gracias a los conocimientos del genoma, que aún no se han desarrollado en el paciente. Se distinguen dos tipos de enfermedades que se pueden diagnosticar mediante la medicina predictiva. Las monogénicas, que se pueden identificar fácilmente ya que se conocen perfectamente las leyes deterministas que las regulan; y las poligénicas, para cuyo buen estudio es necesario realizar sondeos poblacionales. Por ejemplo se pueden encontrar los genes que regulan el nivel de colesterol en la sangre (unos veinte). Determinadas combinaciones de variedades de estos genes sitúan al sujeto en un grupo de riesgo de padecer enfermedades tempranas de las arterias coronarias y ataques cardíacos. Si además el sujeto lleva una dieta rica en grasas animales y una vida sedentaria (también influyen por tanto agentes externos como puede ser el modo de vida y la alimentación), es muy posible que muera de infarto antes de los cincuenta años. La meta es conocer exactamente qué combinaciones de genes son especialmente peligrosas y en esto tiene un papel muy importante el Proyecto Genoma Humano. La medicina predictiva también causa una importante controversia en la sociedad ya que los estudios poblaciones que se realizan para estudiar las enfermedades poligénicas se pueden utilizar para discriminar a ciertas personas o grupos, lo que se llamaría discriminación genética. Este tema se tratará en el apartado Aspectos Éticos.
Aspectos éticos y controversia
Aunque la medicina proporciona la base para la evolución de la bioética, actualmente somos testigos de su aplicación a la investigación científica relacionada. Así pues, el PGH ha dado lugar a una de las áreas de conocimiento biológico con mayor crecimiento. Los conocimientos genómicos derivados del Proyecto Genoma Humano, se utilizan para mejores y más rápidos diagnósticos basados en el análisis directo del ADN, e incluso para el diagnóstico prenatal en aquellos casos en los que se sospecha que el bebé tenga alteraciones morfológicas, funcionales o ponga en peligro la vida de su madre. También es posible aplicar este conocimiento a personas asintomáticas para averiguar si han heredado de algún progenitor una mutación causal de una enfermedad genética que pueda desarrollarse en el futuro.
Así planteado el tema, se percibe entonces una importante brecha entre la capacidad diagnóstica y predictiva del conocimiento genómico por un lado, y la falta de intervenciones preventivas y terapéuticas por otro, lo que lleva a conflictos éticos surgidos del Proyecto Genoma Humano. Además hay determinadas áreas como el asesoramiento a parejas en riesgo de transmitir enfermedades genéticas a su descendencia, que han suscitado mucho interés y para las que se han dictado una serie de principios éticos:
Respeto a la dignidad individual y a la inteligencia básica de las personas, así como a sus decisiones médicas y reproductivas (libre elección de interrumpir o continuar un embarazo con riesgo).
Informar objetivamente al paciente sin tener en cuenta los valores subjetivos del profesional médico.
Protección a la privacidad de la información genética.
Desmitificación del Proyecto Genoma Humano, aclarando verdaderamente su alcance con acciones específicas en educación.
Otro problema de gran importancia es la obtención de patentes de genes por parte de compañías biotecnológicas, gobiernos y centros de investigación universitarios, para una posterior venta o explotación comercial, sin tener en cuenta que parte de los fondos empleados en el PGH era de los contribuyentes. También debemos observar el PGH contextualizado social e históricamente, atendiendo a la desigualdad social y económica entre países, que va a producir una inequidad en el acceso a los beneficios que se extraigan de la investigación.
Una solución a todas estas tensiones podría ser la formación de profesores de ciencias o la enseñanza directa a estudiantes como una forma de abrir las mentes y aclarar definitivamente el alcance del Proyecto Genoma Humano en la sociedad. Pero es imprescindible incorporar temas de bioética a los programas de enseñanza.
Tanto en Estados Unidos como en la Unión Europea se han desarrollado programas para contemplar las consecuencias éticas y sociales de la investigación científica y que no se produzcan conflictos. En Estados Unidos se encuentra el ELSI y fuera de ellos se encuentra la Declaración Universal sobre el Genoma Humano y los Derechos Humanos, promovida por la UNESCO

El ELSI es el Programa Ético, Legal y Social (Ethical, Legal and Social Implications Research Program, en inglés) que desarrolló el NHGRI (National Humane Genome Research Institute, en inglés, o Instituto Nacional de Investigación del Genoma Humano, de Estados Unidos) en 1990. Este programa permite un acercamiento a la investigación científica teniendo en cuenta las implicaciones éticas, legales y sociales que ésta supone, al mismo tiempo que se está investigando para, de esta manera, poder identificar los posibles futuros problemas y solucionarlos antes de que la información científica se extienda. El programa de investigación ELSI tiene un papel muy importante en todo lo relacionado con el PGH, y se encarga de analizar las implicaciones éticas y sociales de la investigación genética de la siguiente manera:
Examinando las ediciones que rodean la terminación de la secuencia humana del ADN y del estudio de la variación genética humana.
Examinando las ediciones llevadas a cabo por la integración de tecnologías e información genética para el cuidado médico y actividades de la salud pública.
Explorando las maneras en las cuales el nuevo conocimiento genético puede actuar recíprocamente con una variedad de perspectivas éticas, filosóficas y teológicas.
Explorando cómo influyen en el uso e interpretación de la información genética, de la utilización de servicios genéticos y del desarrollo de la política, los factores y los conceptos socioeconómicos de la raza y de la pertenencia étnica.
Para alcanzar estas metas, las actividades y la investigación del programa de ELSI se centran en cuatro áreas del programa:
Aislamiento e imparcialidad en el uso y la interpretación de la información genética.
Integración clínica de las nuevas tecnologías genéticas.
Ediciones que rodean la investigación de la genética.
Educación pública profesional.
El ELSI también ha iniciado una serie de emprendimientos educacionales que están dirigidos a entrenar a profesionales de la salud para que puedan interpretar los nuevos tests diagnósticos basados en el ADN que comenzarán a surgir más y más frecuentemente gracias a la información obtenida del PGH. Además de esta formación de profesionales de la salud también se necesita que los políticos y el público en general tengan un criterio suficiente sobre algunos asuntos críticos relacionados con las pruebas genéticas. Por ello, es necesario extender la información genética en las escuelas, los medios de comunicación, alentar la discusión pública sobre el tema y suministrar también información a los políticos. Una de las iniciativas es el establecimiento de la Coalición Nacional para la Educación de los Profesionales de la Salud en Genética (NCHPEG), también en EE. UU., pero rápidamente se queda insuficiente ya que sólo abarca a los profesionales de la Salud.
Declaración Universal sobre el Genoma Humano y los Derechos Humanos]
Así como Estados Unidos tiene un programa para regular las implicaciones sociales y éticas que tienen las investigaciones científicas para tratar de regularlas y que no haya conflictos, la UNESCO redactó en 1997 la “Declaración Universal sobre el Genoma Humano y los Derechos Humanos”, cuyo prefacio es el siguiente:
La Declaración Universal sobre el Genoma Humano y los Derechos Humanos, aprobada el 11 de noviembre de 1997 por la Conferencia General en su 29ª reunión por unanimidad y por aclamación, constituye el primer instrumento universal en el campo de la biología. El mérito indiscutible de ese texto radica en el equilibrio que establece entre la garantía del respeto de los derechos y las libertades fundamentales, y la necesidad de garantizar la libertad de la investigación. La Conferencia General de la UNESCO acompañó esa Declaración de una resolución de aplicación, en la que pide a los Estados Miembros que tomen las medidas apropiadas para promover los principios enunciados en ella y favorecer su aplicación. El compromiso moral contraído por los Estados al adoptar la Declaración Universal sobre el Genoma Humano y los Derechos Humanos es un punto de partida: anuncia una toma de conciencia mundial de la necesidad de una reflexión ética sobre las ciencias y las tecnologías. Incumbe ahora a los Estados dar vida a la Declaración con las medidas que decidan adoptar, garantizándole así su perennidad.
Federico Mayor, 3 de diciembre de 1997.
Está compuesta por 25 artículos que se dividen en las siguientes áreas, destacando en cada una de ellas un determinado artículo:
La dignidad humana y el genoma humano. Contiene los 4 primeros artículos y establece la base la declaración y su objeto, el ser humano y el genoma humano. Cabe destacar el artículo 1: “El genoma humano es la base de la unidad fundamental de todos los miembros de la familia humana y del reconocimiento de su dignidad intrínseca y su diversidad. En sentido simbólico, el genoma humano es el patrimonio de la humanidad”.
Derechos de las personas interesadas. Está compuesta por los artículos desde el 5 al 9 y presenta los derechos que tienen las personas como portadoras de los genes y sus consecuencias sociales. Cabe destacar el artículo 6 porque está relacionado con la discriminación genética, que será tratada más adelante: “Nadie podrá ser objeto de discriminaciones fundadas en sus características genéticas, cuyo objeto o efecto sería atentar contra sus derechos humanos y libertades fundamentales y el reconocimiento de su dignidad”.
Investigaciones sobre el genoma humano. Formada por los artículos 10, 11 y 12. Trata la imposición de la dignidad humana sobre cualquier tipo de investigación relativa al genoma humana, el derecho de todas las personas a acceder a los progresos de la biología y a la orientación de la investigación en el campo de la biología, genética y medicina hacia un alivio del sufrimiento y una mejora de la salud del individuo y de toda la humanidad. Se puede destacar el artículo 10 que alienta a los Estados miembros a actuar sobre posibles conductas contrarias a la declaración: “No deben permitirse las prácticas que sean contrarias a la dignidad humana, como la clonación con fines de reproducción de seres humanos. Se invita a los Estados y a las organizaciones internacionales competentes a que cooperen para identificar estas prácticas y a que adopten en el plano nacional o internacional las medidas que correspondan, para asegurarse de que se respetan los principios enunciados en la presente Declaración”.
Condiciones de ejercicio de la actividad científica. Contiene los artículos del 13 al 16 y en ellos se otorga a los Estados miembros la potestad de regular las actividades relacionadas con la investigación y de crear organismos para regular las consecuencias éticas y sociales causadas por ella, como declarar el artículo 16: “Los Estados reconocerán el interés de promover, en los distintos niveles apropiados, la creación de comités de ética independientes, pluridisciplinarios y pluralistas, encargados de apreciar las cuestiones éticas, jurídicas y sociales planteadas por las investigaciones sobre el genoma humano y sus aplicaciones”.
Solidaridad y cooperación internacional. Esta parte está formada por los artículos 17, 18 y 19 y se refiere a la cooperación y solidaridad tanto entre los individuos que forman los Estados miembros como entre los Estados mismos, refiriéndose en primer lugar a casos como enfermedades genéticas y en el segundo a compartir conocimientos científicos sobre el genoma humano entre países que tengan una gran investigación desarrollada y otros que la tengan menos, como dice el artículo 18: “Los Estados deberán hacer todo lo posible, teniendo debidamente en cuenta los principios establecidos en la presente Declaración, para seguir fomentando la difusión internacional de los conocimientos científicos sobre el genoma humano, la diversidad humana y la investigación genética, y a este respecto favorecerán la cooperación científica y cultural, en particular entre países industrializados y países en desarrollo”.
Fomento de los principios de la Declaración. Son los artículos 20 y 21 e impulsan a los Estados miembros de la UNESCO a fomentar y extender los principios entre los individuos que los forman, también entre los políticos, y además comprometerse a favorecer el debate abierto y la libre expresión de corrientes socioculturales, religiosas o filosóficas. El artículo 20 también impulsa la información desde la educación: “Los Estados tomarán las medidas adecuadas para fomentar los principios establecidos en la Declaración, a través de la educación y otros medios pertinentes, y en particular, entre otras cosas, la investigación y formación en campos interdisciplinarios y el fomento de la educación en materia de bioética, en todos los niveles, particularmente para los responsables de las políticas científicas”.
Aplicación de la Declaración. Los artículos del 22 al 25 se refieren a la obligación de los Estados de fomentar el respeto frente a los enunciados de la Declaración, difundirlos y hacerse cargo de que se realicen correctamente. Así, el artículo 23 declara: “Los Estados tomarán las medidas adecuadas para fomentar mediante la educación, la formación y la información, el respeto de los principios antes enunciados y favorecer su reconocimiento y su aplicación efectiva. Los Estados deberán fomentar también los intercambios y las redes entre comités de ética independientes, según se establezcan, para favorecer su plena colaboración”.
Discriminación genética y patente de genes
Entramos ahora en los que posiblemente sean los dos puntos más importantes de la controversia causada por el PGH, que se pasan a explicar a continuación:
Discriminación genética
El ELSI tiene un papel muy importante en el campo de la discriminación genética. Cuando se dieron los primeros pasos del PGH, los científicos tuvieron muy claro desde el principio que era necesario realizar un estudio ético y social, inicialmente a pequeña escala y si era necesario, a mayor; sobre alguna enfermedad que pudiera tener lugar en la sociedad, para evitar cualquier tipo de discriminación genética. Un ejemplo interesante de discriminación genética tuvo lugar en Estados Unidos durante los años setenta y relacionada con una campaña que realizó el gobierno para detectar portadores del gen de la anemia de células falciformes.
Capilares sanguíneos en los que se pueden observar eritrocitos falciformes.
La anemia de células falciformes, además, tiene un componente relacionado con la raza muy importante, ya que es la enfermedad genética más frecuente entre la población negra. Se trata de una enfermedad recesiva bastante cruel ya que los que la sufren no pueden realizar esfuerzos, ya que corren un grave riesgo de sufrir una insuficiencia respiratoria aguda que les ocasione repentinamente la muerte. Pues bien, la discriminación genética aparece cuando el gobierno realizó un estudio poblacional para detectar individuos que portaran este gen. La anemia de células falciformes no tiene cura y por tanto, si alguien era diagnosticado de anemia de células falciformes no poseía la más mínima esperanza de curación. El problema se hizo patente cuando el gobierno declaró obligatorio en varios estados realizar la prueba de detección a los recién nacidos y a los escolares, sin seguir un programa paralelo de orientación genética que pudiera ofrecer consejo a las familias afectadas, y cuando el público comenzó a confundir a las personas portadoras (heterocigóticas) con las enfermas, debido a la completa falta de una campaña informativa. Por si esto fuera poco, Linus Pauling, que había descubierto el método de análisis de la hemoglobina, realizó unas desafortunadas declaraciones en las que sugería que se marcara de alguna manera a los portadores para que no se mezclaran y no tuvieran hijos entre sí. La información que se recogió en este estudio pasó a formar parte del historial médico de los niños que estaban afectados. Las compañías de seguros comenzaron entonces a negarse a formalizar el seguro si conocían que su posible cliente padecía anemia de células falciformes, e incluso si era simplemente portador del gen. También el mercado de trabajo comenzó a discriminar a los enfermos y portadores. A las personas de color que portaban el gen se les negaba por ejemplo el trabajo en compañías aéreas porque se pensaba que su sangre reaccionaría mal al encontrarse a bajas presiones causados por la altura del avión (algo que es erróneo).
Un gran problema que tuvo el caso de la anemia de células falciformes en los años setenta fue que no se conocían métodos de estudio del feto y que tampoco estaba permitido el aborto. Esto se ha podido superar actualmente y es un problema menor para el programa ELSI, ya que ahora sí existe la posibilidad de detectar la enfermedad en el feto y, además de que ya está permitido, el aborto terapéutico tiene una aceptación social casi mayoritaria.
En definitiva, es necesario realizar un estudio social y ético y dar la información necesaria a la opinión pública para que no se produzcan casos de discriminación genética, si ya no tan llamativos como el de la anemia de células falciformes en EE. UU., pero sí a menor escala como puede ser la predisposición hacia enfermedades cardíacas o a las discapacidades mentales, por ejemplo.
Patente de genes
El concepto de «patente de genes» aparece también con la secuenciación del genoma producida por el PGH. Y es que resulta necesario compatibilizar las expectativas terapéuticas y de avance científico con las expectativas de aspecto económico, procurando encontrar un equilibrio razonable entre el altruismo que unos buscan en el conocimiento público de la información proporcionada por el PGH y otros que encuentran esta información suficiente para sacarle provecho económico. Es necesario combinar la moralidad con el interés económico. El elemento fundamental de todo esto se encuentra en las empresas privadas que realizan investigaciones en el genoma humano. Como tales empresas privadas, necesitan obtener un beneficio que supla las grandes inversiones que hacen en investigaciones para obtener posteriormente productos farmacéuticos, desarrollar terapias clínicas u otras aplicaciones. Para esto, necesitan proteger sus hallazgos para que nadie se aproveche de su esfuerzo. La cuestión reside en determinar cuál es el marco jurídico apropiado para garantizar debidamente esas expectativas de beneficio. Es, por tanto, lógico que se tratara de amparar bajo la protección de las patentes a los descubrimientos relacionados con la descodificación y aislamiento del ADN, considerándolo una sustancia o estructura que, como otras, se encuentra en la naturaleza y de cuyo conocimiento se puede derivar algún uso diagnóstico y con el fin de compensar las inversiones económicas realizadas. De este modo, los investigadores o instituciones que patentaran la secuencia parcial o total de cierto gen podrían ser acreedores de los derechos que se derivaran de ella para la obtención de fármacos. Por otro lado, hay gente que piensa que las patentes no hacen más que impedir el desarrollo biotecnológico y que la información que se encuentra en los genes debería ser de acceso público.
Las patentes sobre secuencias totales o parciales de genes continúan estando en una importante controversia y se pueden encontrar tres posiciones diferentes:
La postura de la UNESCO: afirma que el Genoma Humano es patrimonio de la Humanidad y que debe quedar excluido de cualquier apropiación pública o privada.
La postura estadounidense: representada por los NIH y Craig Venter (dueño de la empresa Celera Genomics, empresa biotecnológica involucrada en el estudio del Genoma Humano). Parten de que los genes, por muy esenciales que sean para la vida, no son vida humana, y tampoco pueden clasificarse como materia exclusivamente humana ya que los compartimos con otras especies. Opinan que no hay nada que choque contra los criterios de patentabilidad impuestos por la USPTO (http://en.wikipedia.org/wiki/USPTO_registration_examination), por lo que nada debería impedirles proteger la información obtenida y conseguir beneficios para poder avanzar en sus investigaciones.
La postura europea: se encuentra en una posición intermedia. Niega la patentabilidad de cualquier genoma individual completo pero admite que se puedan patentar los genes humanos individualmente si han sido aislados. También mantiene cláusulas de moralidad que permitan rechazar administrativa o jurisdiccionalmente determinadas solicitudes de patente. (Directiva Europea 98/44/CE Art. 5 https://web.archive.org/web/20160304212509/http://www.cgcom.org/sites/default/files/54_Directiva_98_44_CE.pdf). La Directiva europea pretende solucionar los problemas de las patentes estableciendo una distinción de planos. Por un lado se encontrarían los genes “tal y como se encuentran en la naturaleza”, que actuarían como patrimonio común de la humanidad y a los que se debe proteger, y por otro lado se encontrarían los genes “que han sido aislados de su medio natural por procedimientos técnicos”, sobre los que sí podría implantarse una patente al haberse modificado su naturaleza a través del procedimiento técnico.
Y ahora qué: el proyecto genoma humano[editar]
.
Cifras y datos

Este diagrama esquemático muestra un gen en relación a su estructura física (doble hélice de ADN) y a un cromosoma (derecha). Los intrones son regiones frecuentemente encontradas en los genes de eucariotas, que se transcriben, pero son eliminadas en el procesamiento del ARN (ayuste) para producir un ARNm formado sólo por exones, encargados de traducir una proteína. Este diagrama es en exceso simplificado ya que muestra un gen compuesto por unos 40 pares de bases cuando en realidad su tamaño medio es de 20 000-30 000 pares de bases).
El Consorcio Internacional, integrado por 20 grupos de diferentes países y por otro lado la empresa privada Celera, hicieron público, el 12 de febrero de 2001, el mapa provisional del genoma humano (GH) que aporta una extraordinaria información acerca de las bases genéticas del ser humano.
El Consorcio Internacional ha calculado que el genoma humano contiene 20 500 genes.
De los 300 000 clones de partida fueron válidos 30 000 clones que representan un total de 3200 megabases. Estos resultados alcanzados en octubre del 2000, representan el 90% del genoma. La secuencia obtenida es de enorme trascendencia y son muchos y variados los puntos de interés pudiendo destacarse algunos datos:
El humano tiene solo el doble de genes que la mosca del vinagre, un tercio más que el gusano común y apenas 5.000 genes más que la planta Arabidopsis.
3200 millones de pares de bases forman genes, repartidos entre los 23 pares de cromosomas. Los cromosomas más densos (con más genes codificadores de proteínas) son el 17, 19 y el 22. Los cromosomas X, Y, 4, 18 y 13 son los más áridos.
El equipo de Celera Genomics utilizó para secuenciar el genoma humano muestras de ADN de tres mujeres y dos hombres (un afroamericano, un chino, un asiático, un hispanomexicano y un caucasiano). El equipo de Celera utilizó ADN perteneciente a doce personas. Cada persona comparte un 99,99 por ciento del mismo código genético con el resto de los seres humanos. Sólo 1250 nucleótidos separan una persona de otra.
Hasta ahora se han encontrado 223 genes humanos que resultan similares a los genes bacterianos.
Sólo un 5 % del genoma codifica proteínas. El 25% del genoma humano está casi desierto, existiendo largos espacios libres entre un gen y otro.
Se calcula que existen entre 250 000 y 300 000 proteínas distintas. Por tanto cada gen podría estar implicado por término medio en la síntesis de unas diez proteínas.
Algo más del 35% del genoma contiene secuencias repetidas. Lo que se conoce como ADN basura.
Se han identificado un número muy elevado de pequeñas variaciones en los genes que se conocen como polimorfismos nucleótidos únicos, SNP de su acrónimo inglés. Celera ha encontrado 2,1 millones de SNP en el genoma y el Consorcio 1,4 millones. La mayoría de estos polimorfismos no tienen un efecto clínico concreto pero de ellos depende, por ejemplo, el que una persona sea sensible o no a un determinado fármaco y la predisposición a sufrir una determinada enfermedad.

Referencias
↑ «BBC NEWS». 14 de abril de 2003. Consultado el 22 de julio de 2006. Texto « Human genome finally complete » ignorado (ayuda); Texto « Science/Nature » ignorado (ayuda)
↑ Baquero F; Nombela C, (18 de julio de 2012). «The microbiome as a human organ». The microbiome as a human organ. PMID 22647038. doi:10.1111/j.1469-0691.2012.03916. Detalles bibliográficos de Proyecto Genoma Humano
Página: Proyecto Genoma Humano
Autor: colaboradores de Wikipedia
Editor: Wikipedia, La enciclopedia libre.
Última revisión: 6 de febrero del 2020, 10:44 UTC
Fecha de consulta: 10 de febrero del 2020, 18:49 UTC
URL permanente: https://es.wikipedia.org/w/index.php?title=Proyecto_Genoma_Humano&oldid=123344887
Código de versión de la página: 123344887

6 febrero 2020

Cambios genéticos previos al CÁNCER

Filed under: GENES,TUMORES — Enrique Rubio @ 15:45

Cambios genéticos previos al CÁNCER

Cambios genéticos previos al CÁNCER

Artículo de investigación del Instituto Europeo de Bioinformática del Laboratorio Europeo de Biología Molecular (EMBL-EBI), en Alemania, y del Instituto Francis Crick, en Reino Unido.
Como ocurre con el Alzheimer, en Cáncer se sospechaba que podría ocurrir algo parecido y ya existían algunos indicios
El cáncer se produce en el organismo poco a poco, los primeros cambios biológicos en el cerebro pueden comenzar hasta 20 años antes de que llegue el diagnóstico.

Este este trabajo que hoy se publica en Nature, está dentro del Proyecto Pancáncer de genomas completos (PCAWG, por sus siglas en inglés), una colaboración internacional en la que han participado de más de 1300 científicos y médicos de cuatro continentes que durante una década han analizado y secuenciado genomas completos de los tipos de tumores más frecuentes. El objetivo era identificar y catalogar los patrones subyacentes de mutaciones que, al final, dan lugar a los distintos tipos de cáncer.
España ha contribuido al proyecto mediante la secuenciación de 95 tumores primarios de leucemia linfática crónica, coordinada por los científicos Elías Campo y Carlos López-Otín y llevada a cabo en el Centro Nacional de Análisis Genómico (CNAG-CRG), que forma parte del Centro de Regulación Genómica (CRG) en Barcelona. Joan Massagué descifra el origen de las metástasis

En algunos tumores, las mutaciones tempranas en tejidos sanos podrían aparecer hasta 10
años antes de que se diagnosticara la enfermedad Legal

En el caso de la enfermedad neurodegenerativa, los primeros cambios biológicos en el cerebro pueden comenzar hasta 20 años antes de que llegue el diagnóstico

En 2600 tumores de 38 tipos de cáncer distintos, muy frecuentes, como pulmón y mama, antes de que el paciente recibiera tratamiento, y han logrado determinar la cronología de cambios genómicos que ocurren en un tejido y que acaban en un cáncer.

“Para más de 30 cánceres ahora sabemos qué cambios específicos han ocurrido y cuando han tenido lugar
Comprender cómo, cuándo y en qué orden ocurren las mutaciones que acaban provocando un tumor y saber si una mutación ocurre de forma temprana o tardía en el historial de un tumor ayudará sin duda a desarrollar mecanismos de detección precoz.

Los autores no solo mapean las mutaciones genéticas, sino que han podido determinar la evolución y los eventos iniciales de muchos tipos de cáncer. En el caso de cáncer de colon, ya se había descrito hace años que diversas secuencias podían conducir a la enfermedad, también en mama. Y logran verlo en distintos tipos de cáncer y en una cantidad muy elevada de pacientes”,
En algunos tipos de cáncer, como el de ovario y los tumores cerebrales glioblastoma y meduloblastoma, han visto que estas primeras mutaciones tienden a ocurrir particularmente pronto y que el desarrollo de un cáncer puede, gestarse durante toda la vida de una persona

De un total de 2600 tumores en los que había 38 tipos de cáncer distintos pero muy frecuentes, como pulmón y mama , antes de que el paciente recibiera tratamiento, han logrado determinar la cronología de cambios genómicos que ocurren en un tejido y que acaban en un cáncer
Los daños genéticos que llevan al cáncer se pueden detectar años antes de la enfermedad
Un consorcio científico internacional publica el mapa más completo del genoma de los 38 tumores más frecuentes
En algunos tumores, las mutaciones tempranas en tejidos sanos podrían aparecer hasta 10 años antes de que se diagnosticara la enfermedad. (utah778 / Getty Images/iStockphoto)
En el caso de la enfermedad neurodegenerativa, los primeros cambios biológicos en el cerebro pueden comenzar hasta 20 años antes de que llegue el diagnóstico. En cáncer, desde hace tiempo se sospechaba que podría ocurrir algo parecido y existían algunos indicios en esa dirección. Ahora investigadores del Instituto Europeo de Bioinformática del Laboratorio Europeo de Biología Molecular (EMBL-EBI), en Alemania, y del Instituto Francis Crick, en Reino Unido, han logrado confirmar esa hipótesis.
Han identificado mutaciones en tejidos sanos que aparecen hasta 10 años antes de que se desarrolle un tumor y que predisponen al individuo a sufrirlo. Para ello, han analizado el genoma completo de más de 2600 tumores de 38 tipos de cáncer distintos, muy frecuentes, como pulmón y mama, antes de que el paciente recibiera tratamiento, y han logrado determinar la cronología de cambios genómicos que ocurren en un tejido y que acaban en un cáncer. Como si se pudiera viajar en el tiempo y tomar miles de fotografías del proceso de creación de Da Vinci y averiguar así con precisión el orden de los trazos en la Gioconda, cuánto tiempo pasó entre uno y otro, y cuáles fueron decisivos para perfilar su misteriosa sonrisa.
Esto indica que ¿Podremos librarnos totalmente del cáncer en el futuro?
“Para más de 30 cánceres ahora sabemos qué cambios específicos es probable que ocurran y cuándo es probable que hayan tenido lugar -afirma Peter Van Loo, investigador del Instituto Francis Crick -. Desvelando estos patrones se abre la puerta a desarrollar nuevas pruebas genéticas que identifiquen indicios de cáncer mucho antes”, añade.
A lo largo de la vida, las células del organismo van adquiriendo mutaciones en su material genético. Forma parte del proceso normal: se dividen y, conforme envejecemos, comienzan a cometer errores al copiar su ADN. Muchos de estos errores no alteran el funcionamiento de la célula y si lo hacen, en la mayoría de ocasiones, la célula deja de ser viable y muere. Se sabe que hay algunos factores, como el tabaco o la predisposición genética, que pueden contribuir a acumular muchas más mutaciones, algunas de ellas perjudiciales, que pueden hacer que la alteración del ADN acabe formando un tumor.
En este sentido, investigadores han logrado, a partir de analizar 47 millones de cambios genéticos en la muestra de tumores que tenían, rebobinar hacia atrás y estimar cuándo se produjeron las alteraciones genéticas que ven en algunos cánceres y medir el progreso de un tumor. Han observado que esas primeras mutaciones en tejidos sanos suponen alrededor del 20% de todas las alteraciones genéticas presentes en tumores.
En algunos tipos de cáncer, como el de ovario y los tumores cerebrales glioblastoma y meduloblastoma, han visto que estas primeras mutaciones tienden a ocurrir particularmente pronto y que el desarrollo de un cáncer puede, de alguna manera, gestarse durante toda la vida de una persona. Como si el organismo fuera una ciudad en la que se van colapsando diferentes vías hasta provocar el colapso.
“Algunos cambios genéticos pueden haber ocurrido años antes del diagnóstico, mucho antes de que aparezca ningún otro indicio de que se ha desarrollado un cáncer y en tejido aparentemente normal”, destaca Van Loo, que considera que este resultado es “realmente sorprendente”.
Comprender cómo, cuándo y en qué orden ocurren las mutaciones que acaban provocando un tumor puede arrojar luz sobre los mecanismos de desarrollo del cáncer. Saber si una mutación ocurre de forma temprana o tardía en el historial de un tumor podría ayudar a desarrollar mecanismos de detección precoz.

“Lo interesante es que no solo mapean esas mutaciones sino que han podido determinar la evolución y los eventos iniciales de muchos tipos de cáncer. En el caso de cáncer de colon, ya se había descrito hace años que diversas secuencias podían conducir a la enfermedad, también en mama. Aquí lo que resulta muy potente es que logran verlo en distintos tipos de cáncer y en una cantidad muy elevada de pacientes”, considera Oriol Casanovas, investigador del Programa ProCURE del Institut Català d’Oncologia (ICO) l’Hospitalet.
Este descubrimiento, que hoy se publica en Nature, se enmarca en el Proyecto Pancáncer de genomas completos (PCAWG, por sus siglas en inglés), una colaboración internacional en la que han participado de más de 1300 científicos y médicos de cuatro continentes que durante una década han analizado y secuenciado genomas completos de los tipos de tumores más frecuentes. El ambicioso objetivo que perseguía este consorcio era identificar y catalogar los patrones subyacentes de mutaciones que, al final, dan lugar a los distintos tipos de cáncer.
España ha contribuido al proyecto mediante la secuenciación de 95 tumores primarios de leucemia linfática crónica, coordinada por los científicos Elías Campo y Carlos López-Otín y llevada a cabo en el Centro Nacional de Análisis Genómico (CNAG-CRG), que forma parte del Centro de Regulación Genómica (CRG) en Barcelona. Joan Massagué descifra el origen de las metástasis

Los resultados de este megaproyecto internacional, que se publican hoy en un conjunto de 23 artículos, seis en Nature y el resto en otras revistas del grupo Nature, trazan el mapa más completo hasta el momento del genoma del cáncer y se han puesto a disposición de todos los científicos del mundo, de forma abierta, lo que tendrá implicaciones para la comprensión del cáncer y de la progresión de los tumores, así como abrirá la puerta a diagnósticos más precoces y a desarrollar nuevas terapias.
Aunque “el genoma de cada paciente es único, hay unos patrones finitos, y con estudios lo suficientemente grandes como éste podemos identificar estos patrones y optimizar el diagnóstico y el tratamiento”, afirma Peter Campbell, miembro del comité directivo del proyecto e investigador del Wellcome Sanger Institute, en el Reino Unido.
Este trabajo ayuda a contestar una dificultad médica mantenida durante mucho tiempo: por qué dos pacientes que parecen tener el mismo cáncer pueden tener resultados distintos con el mismo tratamiento. Este compendio de estudios muestra las razones para ese comportamiento único, * están escritas en el ADN *.
“Por primera vez se liberan datos masivamente a nivel de genoma completo y eso mejora el el líder o tuvo y obtuvo conocimiento que tenemos del cáncer y de los mecanismos que lo inducen y nos abre la puerta a poder investigar en muchas nuevas líneas.
Esto nos ayuda a contestar una dificultad médica de hace mucho: por qué dos pacientes que parecen tener el mismo cáncer pueden tener resultados distintos con el miso tratamiento. Las razones están escritas en el ADN”.
PETER CAMPBELL del Wellcome Sanger Institute, dice El genoma ‘oscuro’ del cáncer, al descubierto.
Afirma que otro de los resultados novedosos de este compendio de estudios es que han analizado el genoma completo de 38 tipos de tumores, los más frecuentes. La mayoría de estudios hasta el momento se centraban en analizar la parte de genoma codificante, que es aquella que alberga los genes que codifican para proteínas, que son la ‘mano de obra’ de las células y se encargan de realizar las funciones necesarias para el organismo. En el Proyecto PanCáncer, los científicos han analizado, por primera vez, el 98% restante
.
“Durante décadas nos hemos centrado en identificar las consecuencias de los cambios en las partes del genoma que codifica para proteínas. Pero muchos cánceres no tienen mutaciones importantes en esa región, aunque algo está provocando ese cáncer. Por inferencia, sospechamos que las regiones no codificantes debían tener un papel importante”, considera Joachim Weischenfeldt, de la Universidad de Copenhaguen, en Dinamarca.
Muchas de las mutaciones que definen el cáncer suceden en ese 2% de región codificante, pero al mirar la región “oscura” los científicos han visto que hay muchos reguladores de esa región brillante. “Mutaciones en esas regiones oscuras del genoma definen si la materia brillante brilla o no. Quizás las proteínas de la región brillante no están alteradas, pero se empiezan a desregular, fragmentos de proteínas se expresan juntos, hacen funciones nuevas, generan, en última instancia, variantes estructurales que acaban conduciendo al cáncer”, comenta Casanovas, del ICO, que no ha participado en este proyecto.
“Por primera vez se liberan datos masivamente a nivel de genoma completo y eso mejora el conocimiento que tenemos del cáncer y de los mecanismos que lo activan y nos abre la puerta a poder investigar nuevas cosas”.
También han hallado nuevas firmas mutacionales, las huellas en el ADN que dejan factores como la radiación solar o el tabaco. Ahora los investigadores de todo el planeta podrán investigar qué sustancias químicas y qué procesos están asociados a esas firmas. “Esto aumentará nuestra comprensión sobre cómo se desarrollar el cáncer y descubrir nuevas causas de cáncer, lo que podrá orientar las estrategias de salud pública para implementar medidas de prevención”, según induce Mike Stratton, director del Wellcome Sanger Institute. Lo que qué tal
“Hasta el momento es como si de un puzle de 100 piezas, solo hubiéramos dispuesto de una colocada. Todo aquello que pasaba fuera de esa pieza no lo podíamos ver y no había manera de hacerlo. Ahora tenemos las 100, podemos ver todo el genoma del tumor”,.

Pero no hay que ser económico, además del tabaco y la radiación solar, se han identificado otros factores capaces de dejar firmas mutacionales en las células. (Xavier Cervera)
Hacia la medicina personalizada
“Los nuevos hallazgos son clave para el desarrollo de una medicina personalizada, una vez que la secuenciación del genoma de un cáncer sea común en el ámbito clínico”, afirma Ivo Gut, director del CNAG-CRG y líder de uno de los grupos de trabajo que forman el PCAWG. “En un futuro no demasiado lejano podremos diagnosticar el tipo de tumor con precisión, predecir con más certeza la progresión que toma un cáncer y qué tratamiento se debe escoger”, añade.
Para Casanovas, del ICO l’Hospitalet, los resultados aportados por el Proyecto PanCáncer servirán para refinar los estudios sobre la enfermedad. “Supondrán un cambio brutal de paradigma. Es como tener el mapa de la materia brillante del universo y, de repente, tener el de la materia oscura, con toda la información que nos faltaba”.
“En un futuro no demasiado lejano podremos diagnosticar el tipo de tumor con precisión, predecir con más certeza la progresión que toma un cáncer y qué tratamiento se debe escoger”.

No solo mapean esas mutaciones sino que han podido determinar la evolución y los eventos iniciales de muchos tipos de cáncer. En el caso de cáncer de colon, ya se había descrito hace años que diversas secuencias podían conducir a la enfermedad, también en mama. Aquí lo que resulta muy potente es que logran verlo en distintos tipos de cáncer y en una cantidad muy elevada de pacientes”,
Los datos estudiado provienen del genoma completo “Eso mejora el conocimiento que tenemos del cáncer y de los mecanismos que lo inducen y nos abre la puerta a poder investigar en muchas nuevas líneas ”, y puede contestar
: por qué dos pacientes que parecen tener el mismo cáncer pueden tener resultados distintos con el miso tratamiento. Las razones están escritas en el ADN”.
La mayoría de estudios hasta el momento se centraban en analizar la parte de genoma codificante, que es aquella que alberga los genes que codifican para proteínas, que son la ‘mano de obra’ de las células y se encargan de realizar las funciones necesarias para el organismo. En el Proyecto PanCáncer, los científicos han analizado, por primera vez, el 98% restante.
“Durante décadas sólo se han visto las consecuencias de los cambios en las partes del genoma que codifica para proteínas. Pero muchos cánceres no tienen mutaciones importantes en esa región, aunque algo está provocando ese cáncer. Por inferencia, sospechamos que las regiones no codificantes tenían que tener un papel importante”, considera Joachim Weischenfeldt, de la Universidad de Copenhaguen, en Dinamarca.
Muchas de las mutaciones que definen el cáncer suceden en ese 2% de región codificante, pero al mirar la región “oscura” los científicos han visto que hay muchos

Mutaciones en esas regiones oscuras del genoma definen si la materia brillante brilla o no. Quizás las proteínas de la región brillante no están alteradas, pero se empiezan a desregular, fragmentos de proteínas se expresan juntos, hacen funciones nuevas, generan, en última instancia, variantes estructurales que acaban conduciendo al cáncer”, comenta Casanovas, del ICO, que no ha participado en este proyecto.
“Por primera vez se liberan datos masivamente a nivel de genoma completo y eso mejora el conocimiento que tenemos del cáncer y de los mecanismos que lo activan y abre la puerta a para investigar nuevos caminos.

Puedo entender el entusiamo de los colegas, pero necesitamos el porque de todo, o cómo empieza todo.
Estamos en ello

23 enero 2020

EL MOVIMIENTO Y LA MEZCLA EN LA EVOLUCIÓN DEL HOMO

Filed under: GENES,genetica — Enrique Rubio @ 21:02

EL MOVIMIENTO Y LA MEZCLA EN LA EVOLUCIÓN DEL HOMO

El ‘Homo sapiens’ surgió de cuatro linajes ancestrales

La secuenciación de genomas de cuatro niños que vivieron en África hace 8.000 y 3.000 años ha demostrado la procedencia del ser humano moderno en África. La procedencia del ser humano es muy discutida desde hace muchos siglos.

Cuando el hombre se enfrenta con lo desconocido puede hacerlo de tres formas, y lo hace en virtud de su preparación y su capacidad
1.- Los muy capaces y muy preparados no tienen problemas, todo lo saben y tienen solución para todo
2.- Los incapaces e ignorantes no tienen solución para nada y por tanto tampoco tienen problemas
3.-Los intermedios, que tiene una discreta preparación y una discreta inquietud, estos no solucionan nada y están siempre inquietos.
De forma que un tema tan complejo como es la evolución de los homínidos, tiene todos los números para que tenga múltiples opiniones y posiblemente ninguna de ellas es verdadera. Pero no se puede prescindir del su búsqueda, hay que continuar porque nuestro futuro depende de un hallazgo acertado es de que todo aquello que nos hace dudar.

Desde que el hombre aprendió a escribir, son múltiples los mensajes y opiniones que tenemos sobre la evolución del homínido. Somos capaces de acertar los comienzos,, pero cuando nos adentramos en la búsqueda, añadimos un porcentaje de ficción.
De forma que nadie se llame a engaño, pero queda lleva impresa siempre un marcado contenido de mentiras, pero también tiene un contenido de verdades, que no era remedio hay que seguir buscando las lentejas comestibles y por tanto hay que escuchar todas las opiniones pero no creerlas todas,

iStock
Sarah Romero
23/01/2020
4 minutos de lectura
Nuestras raíces africanas tienen muchas ramas e interacciones.
La morfología los restos humanos con frecuencia es insuficiente para llegar a conclusiones, sin embargo el estudio del ADN a veces muy difícil por sus condiciones y escasez de marcadamente más útil para este estudió y y haremos un intento de descifrar algunos de ellos

Un equipo internacional dirigido por científicos de la Facultad de Medicina de Harvard (EE. UU.) y con participación española (Instituto de Biología Evolutiva y la Universidad Pompeu Fabra), ha producido las primeras secuencias de ADN humano antiguo de todo el genoma de África occidental y central y confirma que el origen del ser humano moderno se produjo a partir de cuatro poblaciones africanas diferentes que vivieron separadas hace entre 300.000 y 200.000 años.

Este hallazgo refuerza el nuevo argumento formulado por arqueólogos y genetistas acerca de que los orígenes humanos en África podían haber involucrado a poblaciones muy divergentes y geográficamente separadas. El argumento de la mezcla, sobre todo cuando el homo fue evolucionando, es de lo más lógico y creíble.
Los análisis del ADN de los niños del centro-oeste de África, cuyos restos proceden de un lugar rocoso llamado Shum Laka, en una zona de pastizales de Camerún, indican que al menos tres linajes humanos principales, ancestros de los cazadores-recolectores de África central de hoy en día, los cazadores-recolectores del sur de África o los humanos actuales, empezaron a diferenciarse genéticamente entre sí hace unos 200.000 años.

“David Reich de la Facultad de Medicina de Harvard comenta que el análisis que ellos hacen.muestra la existencia de al menos cuatro grandes linajes humanos profundos que contribuyeron a las poblaciones actuales, y que divergieron entre sí hace unos 250.000 y 200.000 años”, comenta

Una cuarta población humana, que se le ha llamado linaje fantasma previamente desconocida, también emergió en ese lapso de tiempo y dejó una pequeña marca genética en los africanos occidentales y orientales modernos, según reza en el estudio que recoge la revista Nature. Dicho linaje ancestral poseía una pequeña cantidad de ADN de poblaciones de homínidos que se habían originado antes del surgimiento de la especie humana, lo que indica que eran posiblemente neandertales. Por el momento, indica la existencia de un linaje de humanos arcaicos que aún no se han identificado.

Se trata de un «linaje fantasma», -un grupo para el que no tenemos evidencia física-, que no parece haber persistido hasta el presente como una población distinta.
Los investigadores intentaron obtener ADN de 18 esqueletos diferentes pero solo tuvieron éxito con cuatro: un niño pequeño y un adolescente de una sola tumba de 8.000 años de edad, y las tumbas vecinas de dos niños de hace aproximadamente 3.000 años. La última fecha es más o menos similar a la del inicio de la expansión bantú, lo que sugiere que estos esqueletos podrían revelarnos muchos detalles sobre su origen.
El genoma mitocondrial, que se hereda de la madre de un individuo, no fue especialmente esclarecedor, ya que coincide con las variantes que se encuentran ampliamente en África. Sí lo fue para uno de los cromosomas Y, una versión poco común que solo se encuentra en unas pocas poblaciones modernas en África y parece haber sido introducida en humanos modernos al cruzarse con un humano arcaico.

Este raro haplogrupo (A00) fue descubierto hace siete años cuando un estadounidense afroamericano que descendía de esclavos, acudió a una empresa de análisis genéticos y obteniendo unos resultados que sorprendieron a todos.

Vista general de la excavación de Shum Laka. Crédito Pierre de Maret
Una especie en movimiento
Un estudio genético previo, dirigido por el genetista evolutivo Pontus Skoglund del Instituto Francis Crick en Londres, identificó una población humana que tuvo su origen hace más de 200.000 años y que era ancestral de los grupos de cazadores-recolectores de la selva tropical del África subsahariana occidental y central. El nuevo estudio proporciona más evidencia de esa línea ancestral, demostrando que la historia de la humanidad no quedaría marcada por la inacción y el aislamiento, sino por el movimiento y la mezcla.
¿Quedarán más sorpresas? Posiblemente. Claro que sí es necesario estar en aviso constante y sólo imaginar lo necesario
Referencia: Ancient West African foragers in the context of African population history, Nature (2020). DOI: 10.1038/s41586-020-1929-1 , https://www.nature.com/articles/s41586-020-1929-1

23 abril 2019

TRANSCRIPTOMA

Filed under: General,GENES,genetica — Enrique Rubio @ 15:37

TRANSCRIPTOMA

El genoma humano está compuesto de ADN (ácido desoxirribonucleico), una molécula larga y serpenteante que contiene las instrucciones necesarias para producir y mantener células. Estas instrucciones se componen de «pares de bases» de cuatro sustancias químicas diferentes, que se organizan en 20,000 a 25,000 genes. Para que las instrucciones puedan llevarse a la práctica, el ADN debe «leerse» y transcribirse, en otras palabras, copiarse para crear ARN (ácido ribonucleico). Estas «lecturas» de genes se llaman transcritos, y un transcriptoma es una colección de todas las lecturas de genes presentes en una célula.
Hay varias clases de ARN. La clase más importante, llamada ARN mensajero (ARNm), desempeña un papel vital en la elaboración de proteínas. En este proceso: el ARNm se transcribe a partir de genes; luego, los transcritos de ARNm se entregan a los ribosomas, las máquinas moleculares ubicadas en el citoplasma de la célula; entonces, los ribosomas leen, o «traducen», la secuencia de las letras químicas en el ARNm y ensamblan componentes básicos llamados aminoácidos para formar proteínas.
El ADN también puede transcribirse a otros tipos de ARN que no codifican proteínas, pero regulan la estructura celular y regulan los genes.
El genoma humano está compuesto de ADN (ácido desoxirribonucleico), una molécula larga y serpenteante que contiene las instrucciones necesarias para producir y mantener células. Estas instrucciones se detallan en la forma de «pares de bases» de cuatro sustancias químicas diferentes, que se organizan en 20,000 a 25,000 genes. Para que las instrucciones puedan llevarse a la práctica, el ADN debe «leerse» y transcribirse, en otras palabras, copiarse para crear ARN (ácido ribonucleico). Estas «lecturas» de genes se llaman transcritos, y un transcriptoma es una colección de todas las lecturas de genes presentes en una célula.
Hay varias clases de ARN. La clase más importante, llamada ARN mensajero (ARNm), desempeña un papel vital en la elaboración de proteínas. En este proceso: el ARNm se transcribe a partir de genes; luego, los transcritos de ARNm se entregan a los ribosomas, las máquinas moleculares ubicadas en el citoplasma de la célula; entonces, los ribosomas leen, o «traducen», la secuencia de las letras químicas en el ARNm y ensamblan componentes básicos llamados aminoácidos para formar proteínas.
El ADN también puede transcribirse a otros tipos de ARN que no codifican proteínas, pero sirven para regular la estructura celular y los genes.
La secuencia de ARN es un reflejo de la secuencia del ADN de la que fue transcrito. Desde la colección completa de secuencias de ARN en una célula (el transcriptoma), se puede determinar cuándo y dónde está activado o desactivado cada gen en las células y los tejidos de un organismo.
Con diferentes técnicas es posible contar el número de transcritos para así determinar la cantidad de actividad de los genes, también llamada expresión génica, en un tipo específico de células o tejidos.
En los seres humanos y en otros organismos, casi todas las células contienen los mismos genes, pero distintas células muestran distintos patrones de expresión génica. Que son los responsables de d distintas propiedades y comportamientos de varias células y tejidos, tanto en la salud como en la enfermedad.
Al comparar los transcriptomas de distintos tipos de células, se pueden entender cómo funciona ese tipo de célula y cómo los cambios de actividad génica pueden afectar o contribuir a las enfermedades. Los transcriptomas pueden conducir a generar al genoma completo y qué genes están activos y en qué células.
La búsqueda en una base de datos del transcriptoma puede dar a los investigadores una lista de todos los tejidos en los que se expresa un gen, y orientar sobre su memoria como trae su devoción función.
En las bases de datos del transcriptoma, los niveles de expresión de un gen desconocido son claramente más altos en células cancerosas que en células sanas, el gen desconocido pudiera desempeñar una función en la proliferación celular. O, si un gen desconocido es expresado en tejido adiposo pero no en tejido óseo o muscular, el gen desconocido pudiera estar implicado en el almacenamiento de grasas o en el metabolismo. En ambos casos, los datos del transcriptoma dan a los investigadores un buen punto de partida para comenzar a buscar la función de un gen recién identificado.
El Proyecto del Transcriptoma Murino fue una iniciativa financiada por el NIH). Estos datos de expresión génica de tejidos específicos, que han sido mapeados en el genoma del ratón, están disponibles en un formato que permite hacer búsquedas en la Base de datos del transcriptoma de referencia del ratón (Mouse Reference Transcriptome Database).
Existen otros recursos de transcriptomas, que incluyen los encontrados en programas del NIH, tales como el Proyecto de expresión del genotipo en tejidos (Genotype-Tissue Expression Project, GTEx) y la Enciclopedia de los Elementos del ADN (Encyclopedia of DNA Elements, ENCODE). GTEx está creando un catálogo de expresión génica humana en una variedad de tejidos diferentes. El objetivo de los investigadores de ENCODE es caracterizar y entender las partes funcionales del genoma, incluido el transcriptoma. Tanto Novartis como el Laboratorio Europeo de Biología Molecular (European Molecular Biology Laboratory) cuentan con bases de datos de expresión génica bien consolidadas.
secuencia de ARN es un reflejo de la secuencia del ADN de la que fue transcrito. Por consiguiente, al analizar la colección completa de secuencias de ARN en una célula (el transcriptoma), los investigadores pueden determinar cuándo y dónde está activado o desactivado cada gen en las células y los tejidos de un organismo.
Dependiendo de la técnica utilizada, a menudo es posible contar el número de transcritos para determinar la cantidad de actividad de los genes, también llamada expresión génica, en un tipo específico de células o tejidos.
En los seres humanos y en otros organismos, casi todas las células contienen los mismos genes, pero distintas células muestran distintos patrones de expresión génica. Estas diferencias son responsables por tantas distintas propiedades y comportamientos de varias células y tejidos, tanto en la salud como en la enfermedad.
Al obtener y comparar los transcriptomas de distintos tipos de células, los investigadores pueden adquirir un entendimiento más a fondo de lo que constituye un tipo específico de célula, cómo funciona normalmente ese tipo de célula y cómo los cambios en el nivel normal de actividad génica pudieran afectar o contribuir a las enfermedades. Además, los transcriptomas pudieran habilitar a los investigadores a generar un panorama exhaustivo sobre el genoma completo de qué genes están activos en qué células.
Todavía se desconoce la función de la mayoría de los genes. Una búsqueda en una base de datos del transcriptoma puede dar a los investigadores una lista de todos los tejidos en los que se expresa un gen, ofreciendo pistas sobre su posible función.
Por ejemplo, si la base de datos del transcriptoma muestra que los niveles de expresión de un gen desconocido son radicalmente más altos en células cancerosas que en células sanas, el gen desconocido pudiera desempeñar una función en la proliferación celular. También si un gen desconocido es expresado por tejido adiposo pero no en tejido óseo o muscular, el gen desconocido pudiera estar implicado en el almacenamiento de grasas o en el metabolismo. En ambos casos, los datos del transcriptoma dan a los investigadores un buen punto de partida para comenzar a buscar la función de un gen recién identificado.
El Instituto Nacional de Investigación del Genoma Humano (National Human Genome Research Institute, NHGRI), que es parte de los Institutos Nacionales de la Salud (National Institutes of Health, NIH), ha participado en dos proyectos que crearon recursos de transcriptomas para investigadores alrededor del mundo, la iniciativa de la Colección de Genes Mamíferos (Mammalian Gene Collection) y el Proyecto del Transcriptoma Murino (Mouse Transcriptome Project).
La iniciativa de la Colección de Genes Mamíferos creó una biblioteca pública gratuita de secuencias de ARNm de seres humanos, ratones y ratas. El proyecto fue dirigido por el NHGRI y el Instituto Nacional del Cáncer (National Cancer Institute, NCI), que también forma parte del NIH. El ratón y la rata son modelos importantes con los que se estudia la biología humana.
El objetivo de los investigadores de ENCODE es caracterizar y entender las partes funcionales del genoma, incluido el transcriptoma. Tanto Novartis como el Laboratorio Europeo de Biología Molecular (European Molecular Biology Laboratory) cuentan con bases de datos de expresión génica bien consolidadas.
En el Instituto de Oncología de Vall d’Hebron (VHIO), se analizan la actividad de los genes en un cáncer, y no sólo las mutaciones genéticas que contiene, ayuda a decidir el mejor tratamiento para cada paciente .
En la actualidad existe un número importante de terapias dirigidas, de manera selectiva a moléculas de los tumores. Pero esta terapia estas terapias es eficaz sólo contra una minoría de cánceres. Concretamente, contra aquellos que tienen la molécula concreta que el fármaco utiliza como diana. De ahí que hoy en día sea habitual analizar el genoma de los tumores para saber qué mutaciones tienen en su ADN y con qué fármacos se podrían atacar.
Sin embargo, los fármacos no atacan directamente el ADN sino proteínas que se producen a partir de este ADN. Para que se produzcan las proteínas, un fragmento de ADN debe producir primero una molécula llamada ARN mensajero. A partir de este ARN mensajero, se fabrican después las proteínas.
Por lo tanto, el transcriptoma informa de qué genes están activos en una célula. Es decir, qué genes están produciendo proteínas y cuáles son las proteínas que se producen. En el caso del cáncer, el transcriptoma podría indicar de manera aún más precisa que el genoma qué proteínas se pueden atacar con fármacos. Esta era la hipótesis de partida del estudio Winther, que el hospital Vall d’Hebron ha realizado junto a hospitales de Estados Unidos, Canadá, Francia e Israel.
En la investigación, se realizaron análisis del genoma o del transcriptoma en tumores de 107 pacientes con cánceres en estadio avanzado y con escasas opciones de tratamiento. Un 34% tenían cánceres colorrectales, fue el tipo de tumor más común en la muestra analizada, seguido del de cabeza y cuello (21%) y el de pulmón (20%).
Médicos de todos los hospitales participantes en el estudio realizaron teleconferencias semanales para decidir de manera individualizada el mejor tratamiento para cada paciente a partir de los datos del genoma y del transcriptoma. Los tratamientos no se limitaron ni a fármacos ni a indicaciones ya aprobados. Si los datos de los genomas o los transcriptomas sugerían que un fármaco podía ser útil para un tipo de cáncer para el que aún no había sido aprobado, los médicos no dudaban en administrarlo. Y si consideraban que era mejor un fármaco experimental, aún no aprobado, este era el que recibían los pacientes.
Según los resultados presentados en la revista Nature Medicine , el porcentaje de pacientes en los que la enfermedad seguía estable seis meses después de iniciar el tratamiento fue del 23% cuando la decisión se tomó a partir del análisis del genoma. Cuando se tomó a partir del análisis del transcriptoma, el porcentaje ascendió al 31%. Y
“Ambos [análisis] son útiles para mejorar las recomendaciones de tratamiento y la evolución de los pacientes”, concluyen los investigadores. Sin embargo, “la transcriptómica incrementó de manera sustancial el porcentaje de y pacientes a los que se pudo administrar una terapia coincidente” con el perfil de su tumor.
Los investigadores atribuyen el hecho de que el cáncer progresara en la mayoría de pacientes a que iniciaron el tratamiento cuando la enfermedad estaba ya muy avanzada.
Aun así, refieren los casos de dos pacientes que tienen la enfermedad estable tres años después de iniciar el tratamiento y de un tercero al que no le queda ningún rastro detectable de cáncer. Pero advierten que los análisis de transcriptomas, que ya se aplican en entornos de investigación, aún no son habituales en el tratamiento de pacientes en hospitales.
Bibliografia
Instituto Nacional de Investigación del Genoma Humano (National Human Genome Research Institute, NHGRI), Colección de Genes Mamíferos (Mammalian Gene Collection) y el Proyecto del Transcriptoma Murino (Mouse Transcriptome Project).
Estudio Winther, que el hospital Vall d’Hebron ha realizado junto a hospitales de Estados Unidos, Canadá, Francia e Israel.
Josep Tabernero, director del Instituto de Oncología de Vall d’Hebron (VHIO) y coautor de la investigación (Àlex Garcia) Nature Medicine.

LA VANGUARDIA 23.4.2019. Corbella

16 junio 2018

DIGITALIZACION DE LA GENOMICA

Filed under: GENES — Enrique Rubio @ 12:41

DIGITALIZACION DE LA GENOMICA
Ali Torkamani Eric J Topol
Publicado: 16 de junio de 2018

Hay alguna manera de simplificar la genetica y colocarla a nivel de medicina basica. rapida de hacer e interpretar y barata y al alcance de gente no versada.
Cada día hay más discordancia entre el investigador que se polariza a un tema y que parece no tener prisa, y el médico que trata de curar al dolorido.
Cuando leo un artículo, me ilusionó siempre que la posibilidad de tenerlo muy rápidamente en mis manos y usarlo .
Cuando apareció el sistema CRISPR descubierto por el Dr Mojica, encontramos una herramienta de edición del genoma que actúa como unas tijeras moleculares capaces de cortar cualquier secuencia de ADN del genoma de forma específica y permitir la inserción de cambios en la misma.
Los años setenta marcaron el inicio de la Era de la Ingeniería Genética, en la que importantes hitos, como la producción de insulina a partir de Escherichia coli o la utilización de ratones transgénicos en el estudio de enfermedades humanas, cambiaron el curso de la medicina. Sin embargo, los métodos utilizados no dejaban de ser imprecisos y difíciles de aplicar a gran escala, resultando en experimentos complicados y costosos.

El perfil genético está creciendo con proyecciones de que más de mil millones de personas tendrán sus genomas secuenciados para el año 2025. Pero fuera de las pruebas prenatales y hereditarias de cáncer, el tratamiento del cáncer y el diagnóstico de enfermedades raras,
Pero los datos genéticos tienen una utilidad limitada y se utilizan con poca frecuencia para planes médicos preventivos o terapéuticos de rutina.
Los consumidores normalmente se conectan con datos genómicos personales de forma aislada y existe una interoperabilidad escasa o nula entre nuestros registros electrónicos de salud y nuestra genómica. Necesitamos una integración de datos genómicos y esto agrega un nuevo nivel de complejidad.
Es imprescindible abreviar y simplificar estas técnicas, de forma que el conocimiento genético, permitan tomar decisiones por los médicos. De forma pues que es necesario darse prisa y no seguir defraudando al paciente y al medico responsable de este directaente, y en ello las nuevas herramientas digitales ocuparán un lugar central.
Los avances en las tecnologías de secuenciación y las plataformas de análisis han llevado a un auge en el conocimiento genómico y han ayudado a identificar variantes de ADN asociadas con la susceptibilidad a enfermedades comunes como la enfermedad cardíaca aterosclerótica, la diabetes y el cáncer. La mayoría de las variantes de ADN común asociadas a la enfermedad se pueden evaluar con genotipado.
Nuestra comprensión de todos los factores genéticos que influyen en las enfermedades comunes es incompleta y ello es motivo de que todavía no tengan un amplio uso clínico, los puntajes de riesgo genético (GRS) se han publicado para muchas afecciones comunes y los datos acumulados de las publicaciones de GRS han posicionado su uso potencial para evaluar la susceptibilidad individual antes de que ocurra una enfermedad.
Un GRS es una suma de las variantes genéticas individuales que se sabe que están asociadas con una enfermedad específica pero que dan diferentes pesos a las variantes según la magnitud de las asociaciones de enfermedades. Y el , GRS proporciona información complementaria más allá de los factores de riesgo clínicos tradicionales para diversas afecciones médicas. Muchas de las decisiones que los pacientes toman para tomar ciertos medicamentos, someterse a procedimientos o incluso comer ciertos alimentos se basan en la evidencia basada solo en variables clínicas y no en datos detallados a nivel individual.
En la enfermedad de las arterias coronarias (CAD), el estado de fumar cigarrillos, la presión arterial, el control de la glucosa y el colesterol se utilizan para la determinación del riesgo y, posteriormente, los objetivos para la optimización. En efecto, estos factores de riesgo clínicos se han incorporado a las calculadoras de uso común para diseñar estrategias de prevención como el inicio de las estatinas, pero la incertidumbre debida a la sobreestimación del riesgo es una preocupación.
CAD GRS es una herramienta útil para abordar esta incertidumbre, mediante la identificación de las personas con más probabilidades de beneficiarse del inicio de la estatina. Las aplicaciones para teléfonos inteligentes y las herramientas basadas en la web tienen el potencial de aportar esta información adicional sobre el riesgo genético para una enfermedad determinada y ofrecer un nuevo nivel de predicción que se utilizará junto con las calculadoras de riesgos tradicionales.
En el futuro, mediante el uso de teléfonos inteligentes, tanto los pacientes como los médicos tendrán acceso a la información de GRS para múltiples enfermedades en tiempo real para su uso en la toma de decisiones clínicas. CAD GRS es una herramienta útil para abordar esta incertidumbre, mediante la identificación de las personas con más probabilidades de beneficiarse del inicio de la estatina. Las aplicaciones para teléfonos inteligentes y las herramientas basadas en la web tienen el potencial de aportar esta información adicional sobre el riesgo genético para una enfermedad determinada y ofrecer un nuevo nivel de predicción que se utilizará junto con las calculadoras de riesgos tradicionales. En el futuro, mediante el uso de teléfonos inteligentes, tanto los pacientes como los médicos tendrán acceso a la información de GRS para múltiples enfermedades en tiempo real para su uso en la toma de decisiones clínicas.
La estimación de GRS específicos de la enfermedad es solo el primer paso. Nuestros genes funcionan en concierto con nuestras exposiciones ambientales (tanto externas como internas) para determinar resultados específicos. Todavía estamos en una etapa inicial de integración de los datos de varias capas de cada individuo, que podrían incluir datos clínicos y genómicos, exposiciones ambientales, microbioma e inmunoma, y datos sociales y del comportamiento. Todos estos componentes son dinámicos, complejos e interactivos, lo que engendra la necesidad de una IA de aprendizaje profundo para ayudar a proporcionar ideas personalizadas para cada individuo. Tomará tiempo antes de que esos datos se procesen de manera significativa, pero la investigación sobre el uso de GRS ya está proporcionando información valiosa.
Una de las fortalezas más tangibles de un GRS es que puede calcularse al comienzo de la vida y en ausencia de factores de riesgo de enfermedad tradicionales, muchos de los cuales solo se manifiestan a mitad de la vida y más allá, para informar un riesgo de enfermedad a lo largo de la vida. . La prevención óptima de enfermedades no comienza a mitad de la vida. La digitalización del riesgo genético finalmente llevará a la prevención individualizada de la enfermedad en juego.
Como resumen esta tecnología tiene que simplificarse. y hacerse más fácil de aplicar.
Cuando venga el lobo de verdad no nos lo vamos a creer, aunque todos intuimos que esta cerca y además lleno de lógica.

Scripps Translational Science Institute
1. Khera, AV, Emdin, CA, Drake, I et al. Riesgo genético, adherencia a un estilo de vida saludable y enfermedad coronaria. N Engl J Med . 2016 ; 375 : 2349-2358
2. Knowles, JW y Ashley, EA. Enfermedad cardiovascular: el aumento del puntaje de riesgo genético.PLoS Med . 2018 ; 15 : e1002546
3. Phillips, KA, Deverka, PA, Hooker, GW y Douglas, MP. Disponibilidad y gasto de pruebas genéticas: ¿dónde estamos ahora? ¿A dónde vamos?. Salud Aff . 2018 ; 37 : 710-716
4. Torkamani, A, Andersen, KG, Steinhubl, SR, y Topol, EJ. Medicina de alta definición Cell . 2017 ; 170: 828-843
5. Torkamani, A, Wineinger, NE, y Topol, EJ. La utilidad personal y clínica de los puntajes de riesgo poligénicos. ( publicado en línea el 22 de mayo ) Nat Rev Genet . 2018 ;

Powered by WordPress