Enriquerubio.net El blog del Dr. Enrique Rubio

29 febrero 2020

LAS DRUSAS MACULARES PARA PREVENIR LA DMAE

Filed under: DEGENERATIVAS — Enrique Rubio @ 21:16

BORRAR LAS DRUSAS MACULARES PARA PREVENIR LA DMAE

¿Que son las drusas?
Las drusas son depósitos amarillos debajo de la retina. Están formadas por lípidos, una proteína grasa. Es probable que las drusas no causen degeneración macular relacionada con la edad (DMRE), pero tener drusas aumenta el riesgo de una persona de desarrollar DMRE.
Existen diferentes tipos de drusas. Las drusas “duras” son pequeñas, bien delineadas y alejadas unas de otras. Es posible que este tipo de drusas no provoquen problemas con la visión durante largo tiempo, si es que en algún momento los provocan.
Las drusas “blandas” son grandes y se agrupan más cerca unas de otras. Sus bordes no están tan claramente definidos como en el caso de las drusas duras. Este tipo de drusas, las blandas, aumentan el riesgo de DMRE.

Drusas del nervio óptico
Las drusas también se pueden producir en el nervio óptico. Estas drusas están formadas por proteínas y sales de calcio, y generalmente aparecen en ambos ojos. A diferencia de las drusas asociadas con la DMRE, las drusas del nervio óptico (también conocidas como drusas del disco óptico) no están relacionadas con el envejecimiento y con frecuencia aparecen en niños. Las drusas del nervio óptico generalmente no afectan la visión, pero algunos pacientes con estas drusas pueden perder la visión periférica (lateral).

Las drusas maculares se localizan cuando aparecen, entre la membrana basal y emigran del epitelio pigmentario de la retina (EPG) y la membrana de Bruch.

Se presentan como nódulos de color blanco o amarillo, de diferentes tamaños y, si no se asocian a una lesión de la mácula, no suelen producir síntomas. Son los residuos en definitiva que el cuerpo no es capaz de eliminar a través de la circulación sanguínea y se almacenan pudiendo aparecer en el nervio óptico o en la mácula del ojo (zona central de la retina que nos permite percibir los detalles).28 ene. 2018
Las inyecciones de líquido subretiniano son una terapia emergente para eliminar drusas maculares y prevenir la degeneración macular asociada a la edad (DMAE).

Hasta fechas recientes poco se podía hacer para eliminar las drusas, que en muchos casos son un paso inicial en la degeneración macular asociada a la edad (DMAE), una enfermedad que altera la visión y que, en sus formas más graves, progresa a ceguera. “Las drusas mayores de 125 micras tienen riesgos”.
Una serie de autores se han preocupado por destruyen o disminuya el
Hugo Quiróz-Mercado, exdirector del Laboratorio de Cirugía Experimental del Hospital Luis Sánchez de la Asociación para la Prevención de la Ceguera (México). Este oftalmólogo relata que las drusas pueden verse incluso en pacientes con agudeza visual 20/20 y ya operados de cataratas.
“A los pacientes podemos decirles que no fumen, que coman zanahorias, que cuiden su salud, pero su visión irá deteriorándose hasta desembocar en una degeneración macular húmeda, que es la que ocasiona la grave y rápida disminución de la agudeza visual”. De hecho, supone en torno al 10 por ciento de todas las DMAE, pero en el 90 por ciento de los casos conducen a la ceguera un
“Los depósitos que se forman bajo el epitelio pigmentario retiniano (EPR) tienen una fisiopatología muy compleja desde el punto de vista bioquímico y genético, las son €kojh ocurrió con en depósitos amarillos que se forman entre el EPR y la membrana de Bruch, y que dependiendo de su tipología producen manchas borrosas o negras en el campo visual.
A día de hoy se ensayan diferentes terapias a base de inyecciones subretinianas, energía láser subumbral, vitrectomía pars plana y medicamentos para la DMAE húmeda. “Introducir líquido subretiniano en los agujeros maculares, hubo una sola sino la da elasticidad a la retina”, avanza el experto, que confía menos en el láser subumbral porque, a pesar de disminuir las drusas los pacientes siguen desembocando en una DMAE húmeda o seca. No obstante cree que separando los pacientes con drusas de los que tienen depósitos drusoides, podría tratarse con más precisión. La tomografía de coherencia óptica (OCT) revela que el 14 por ciento de los pacientes con drusas tienen oculta una membrana neovascular coroidea –vasos sanguíneos nuevos y dañinos que crecen en la coroides-. Eso podría ser el impedimento para prevenir la DMAE con láser subumbral.
También quiso repasar lo que ocurre con otras cirugías que logran eliminar drusas, aunque en casos individualizados. Así, un paciente con agudeza visual (AV) de 20/60 y drusas al que se le desprende la retina y presenta una AV de 20/100, pero al año de la operación su AV es de 20/25 y las drusas han disminuido.
“Estamos viendo que en pacientes con agujero macular las drusas se modifican, o sea, que algo pasa con la cirugía”, incide el oftalmólogo, recordando el estudio de Luis fuerte con otro paciente a quien le desaparecieron las drusas en el ojo intervenido por agujero macular (pasó de AV 20/200 a 20/25), pero en el ojo no operado siguió con 20/100. “Y con el síndrome de tracción vítreomacular pasa algo muy interesante. Al 60 por ciento de los pacientes que además tienen drusas les desaparecen simplemente haciéndoles la vitrectomía. La explicación podría ser que al quitar el vítreo se oxigena la retina.
uno de los objetivos futuros es saber qué sucede en el espacio subretiniano a nivel molecular
Otros tratamientos singulares que alcanzan resultados pioneros son la nyección subretinal de solución salina balanceada para irrigación oftálmica, que inicialmente muestra beneficios superiores a la terapia génica; o, en algunos casos, si no desaparecen las drusas con la inyección, los pacientes podrían beneficiarse de cirugía, con vitrectomía. “Sería interesante que pudiéramos inyectar una sustancia con péptidos mediadores que propicien un mejor funcionamiento del EPR.

Aparecen aquí nuevas pistas. El uso de terapias anti-integrinas en diabetes se relaciona con el estrés oxidativo, pero también con la neurodegeneración en retinopatía diabética. En algunos trabajos se ha visto menos isquemia cuando se usa terapia anti-integrinas en modelos animales. En el laboratorio experimental de Quiróz-Mercado utilizaron células neuronales y de EPR y se comprobó una sobrevida celular si se someten a estrés con un ácido determinado, incluso con peróxido. Secuencialmente otros investigadores han visto con el mismo tratamiento una protección de las mitocondrias, o un efecto neuroprotector de las anti-integrinas. Esto último también se ha experimentado cultivando células de epitelio pigmentario humano, incluso se ha visto en expresión genética.
Ellos han provocado daño en el nervio óptico de ratas y las han tratado con y sin integrinas, resultando que las células ganglionales están más preservadas en el grupo de las anti-integrinas. En 2017, su equipo de investigación logró mejorar la visión con una terapia anti-integrinas en 12 pacientes que presentaban drusas y disminución de la agudeza visual.
Un estudio multicéntrico de la Universidad de Miami concluye que todos los pacientes que recibieron inyección intravítrea de anti-integrinas mejoraron la agudeza visual.
La presencia de drusas calcificadas retinianas en pacientes con degeneración macular relacionada con la edad (DMAE) se asocia con un riesgo más de seis veces mayor de progresión tardía de la enfermedad, según un reciente artículo de investigación publicado en Science Translational Medicine. Los investigadores correlacionaron las características de las imágenes funduscópicas con la histología de los ojos de donantes fallecidos con DMAE.

Drusas calcificadas

En una cohorte de pacientes con DMAE, se observó una mayor progresión a formas avanzada en aquellos que tenían evidencia histológica y en las imágenes del fondo de ojo de patrones extensos de nódulos de hidroxiapatita policristalina que se acumulan en la retina. Investigaciones anteriores ya habían vinculado el patrón de reflexión interna heterogénea dentro de las drusas con la progresión de la DMAE, pero este es el primer estudio que identifica la composición de las drusas.

DMAE avanzada

Los análisis de regresión demostraron una asociacion independiente muy significativa entre la reflectividad interna de las drusas y la progresión a formas de DMAE avanzada a los 12 meses (odds ratio, 6,36; IC del 95%, 2,99 a 13,53; p <0,001). Los hallazgos sugieren que la reflectividad interna podría tener un valor pronóstico para la DMAE neovascular y la atrofia geográfica. La patologías degenerativas tienen una morfología al y función repetitiva. Un germen o cualquier tipo de agresor o varios agresores a la vez invaden una estructura orgánica, y como respuesta inmunológica se precipitan sobre el lugar invadido una variedad grande de macrófagos . Lo que viene después es el verdadero mutilante de la estructura. Esto no parece diferente al Alzheimer, Parkinson, Ela y otras varias enfermedades degenerativas y de lo que se trata es de quitar el depósito de macrófagos que es el productor del daño pero lo que iniciar el cuadro es posiblemente un germen o varios a la vez. Y el caso de las Drusas en la Retina, es mas de lo mismo. Las estructuras oculares son tan superficiales, que cualquier partícula viviente o no quería más de desencadenar el algoritmoGermenes variados y multiples, abandonan las grandes cavidades del orgasnismo. Se alojan en distintos parénquimas y entre ellos en el sistema nervioso Las vias por las que estos germenes, perforan los intestinos y se alojan en cualquier parte, pueden ser muy bien el Vago que extiende a todas partes. Los macrofagos de los mas variados, que en condiciones normales tienen funciones fisiológicas, cuando reciben avisos de infección microbiana, agreden a estos germenes y anulan las partes del sistema nervisoso donde asientan. Los germenes pueden ser multipples y variados, los macrofagos lo mismo y las lesiones que se producen destruyen todo lo que se les pone por delante y adema con carácter progresivo. Acuerdense de las vacunas que cuando evitaban la reproducion del germen no solo evitaban la enfermedad, sino la hacían desaparecer. Podíamos con esto decir que las druzas y sus lesiones de la retina son una enfermedad degenerativa también, y un germen puede poner en marcha el proceso. Cabe la pregunta de dónde está el germen o los germenes

28 febrero 2020

Los tumores agresivos generen resistencia a la quimioterapia

Filed under: General — Enrique Rubio @ 19:13

Células tumorales de adenocarcinoma de páncreas que muestran signos de daño en el ADN del núcleo (puntos blancos) y de micronúcleos (en verde), después de un tratamiento con taxol seguido de inhibidores de CDK4/6.
IMPEDIR QUE LOS TUMORES AGRESIVOS GENEREN RESISTENCIA A LA QUIMIOTERAPIA
El término “cáncer” engloba un amplio conjunto de enfermedades cuya característica principal es la multiplicación incontrolada de un grupo de células que pueden invadir tejidos contiguos.
En condiciones normales una célula se multiplica de manera controlada siempre que el cuerpo lo necesite. Durante la infancia las células se multiplican constantemente para permitir el crecimiento; mientras que en la edad adulta, las células se multiplican para reemplazar a las que mueren o para reparar heridas. Cuando las células son viejas o están dañadas el cuerpo lo detecta y envía señales para que mueran (esto se denomina “apoptosis”).
Las células cancerosas (también llamadas tumorales) se diferencian de las normales en muchos aspectos que permiten esta multiplicación sin control:
• son menos diferenciadas (se parecen menos a las células de tejidos normales).
• son capaces de ignorar las señales que evitan que la célula se divida o muera, por lo que se multiplican incontroladamente.
• son capaces de influir en los tejidos que les rodean y crear un entorno que favorezca su propio crecimiento.
• algunas adquieren la capacidad de evadir el sistema inmune (sistema que protege al organismo de infecciones o agentes externos) o incluso de utilizarlo para aumentar su crecimiento.
Las células tumorales pueden extenderse a otras partes del cuerpo a través de los vasos sanguíneos o los ganglios linfáticos, esto es lo que conocemos como metástasis.

En el cáncer son comunes una serie de cambios en los genes que controlan la función de las células. Estos cambios se pueden adquirir a lo largo de la vida debido a errores acumulados en la multiplicación normal de las células. Una de las causas puede ser las exposiciones medioambientales (tabaco, alcohol, radiaciones ultravioletas…). En otros casos y de manera menos frecuente (5-10%), las personas pueden presentar una predisposición genética a desarrollar cáncer debido a que han heredado genes ya alterados, se trata de lo que conocemos más comúnmente como cáncer hereditario.
El algoritmo de multiplicación celular en el cáncer, no es simple y en consecuencia la terapia es no acertada la mayoría de las veces para el control de la multiplicación celular
Se cree que puede que Beata variedad de radicales yo estaba dado de alta en la comp en vuestra acompañan a Ecuador con la que el tono que y que el estado de metal realizando una labor que ya he cambiado a la luz cuando las células destruye la mitad el que acabó derrotado un beta poquillo y lo está cambiando y se cultiva están viendo a otra compañía que bajo el agua que no lo tengo o Zedillo del hotel o mediano úrico en variar, me ha dado una cosa o más de lo que ya no soy el lado, Las moléculas CDK4 y CDK6 están implicadas en el crecimiento celular descontrolado que acaba generando una masa tumoral
En este artículo se muestra la acción de dos inhibidores de CDK4/6 sean usados, no al mismo tiempo que la quimioterapia, sino después de la misma.

Células tumorales de adenocarcinoma de páncreas que muestran signos de daño en el ADN del núcleo (puntos blancos) y de micronúcleos (en verde), después de un tratamiento con taxol seguido de inhibidores de CDK4/6. Un día

Esta investigación está dirigida por el Centro Nacional de Investigaciones Oncológicas (CNIO) en colaboración con investigadores del Centro Weill Cornell Medicine y Pfizer Inc (Estados Unidos), propone una nueva estrategia combinada para evitar la resistencia del cáncer de páncreas a la quimioterapia. De esta forma se puede lograr que los tratamientos puedan eliminar estas células tumorales de manera eficaz. El trabajo se publica en la revista Cancer Cell.
Su eficacia en el cáncer de mama
El cáncer es la alteración del ciclo celular, es decir, la actividad normal relacionada con el crecimiento, maduración y muerte de las células. Las moléculas CDK4 y CDK6 están implicadas en el crecimiento celular descontrolado que acaba generando una masa tumoral.

En los últimos años, se han desarrollado unos fármacos que inhiben la acción de CDK4 y lo mal y la Madre DK6 y son muy eficaces para detener el crecimiento del cáncer de mama avanzado. Su uso clínico ya está aprobado para las pacientes de este tipo de cáncer, en combinación con terapia hormonal, y se ha convertido en el tratamiento estándar para estas pacientes. Sin embargo, hasta ahora no estaba claro si estos beneficios se podrían extender a otros tipos de cáncer.
“Un problema de los inhibidores de CDK4/6 viene dado por su mecanismo de acción que impide que las células tumorales se dividan”, explica Marcos Malumbres, jefe del grupo de División Celular y Cáncer del CNIO e investigador principal del proyecto. “La mayor parte de las quimioterapias actuales –como los derivados de platino o taxol, entre otras–, actúan solo precisamente sobre las células tumorales que se están dividiendo. Por tanto, si inhibimos CDK4/6 y evitamos así que estas células se dividan, impedimos que las quimioterapias funcionen correctamente. Por este motivo, hasta ahora se ha creído que no podíamos combinar los inhibidores de CDK4/6 con quimioterapia clásica”.
Nueva estrategia
Beatriz Salvador, investigadora del CNIO diseñó una nueva estrategia en la que los inhibidores de CDK4/6 sean usados, no al mismo tiempo que la quimioterapia, sino después de la quimioterapia para impedir la recuperación de las células tumorales. Los resultados del trabajo muestran que aplicar los inhibidores de CDK4/6 a continuación de los fármacos comúnmente usados en diversos tumores metastásicos impide que las células tumorales resistan estos tratamientos y vuelvan a crecer tras suministrar quimioterapia.
El trabajo se ha desarrollado tanto en modelos de ratón modificados genéticamente como en ratones con injertos de pacientes con adenocarcinoma de páncreas. Las células tumorales tratadas con taxol u otros agentes reparan en pocos días el daño que les han producido estos agentes terapéuticos. Por su parte el tratamiento adicional con inhibidores de CDK4/6 impide esta reparación de las células tumorales y hace que continúen acumulando daño, evitando así que sigan creciendo. “Todos los animales tratados con esta combinación mostraron un tumor estable, mientras que los ratones que no fueron tratados con ella perecieron rápidamente”, continúa Malumbres.
El tratamiento más frecuenta para los casos de cáncer metastásico sigue siendo la quimioterapia clásica. “Poder usar inhibidores de CDK4/6 para impedir que las células tumorales se recuperen de estos tratamientos puede abrir nuevas vías para mejorar la eficacia de estas terapias en diversos tipos de cáncer, que en la actualidad se tratan con radioterapia o quimioterapia clásicas”, indica Malumbres. Esta nueva estrategia podría impactar positivamente en miles de pacientes que se tratan en la actualidad con estas terapias. “Sin embargo, esta estrategia ha de ser validada en la clínica. Actualmente estamos en contacto con compañías farmacéuticas para mover esta propuesta a ensayos clínicos, probablemente en cáncer de mama y de pulmón”.
Este trabajo ha sido financiado por el Ministerio de Ciencia e Innovación, el Instituto de Salud Carlos III, el Fondo Europeo de Desarrollo Regional, la Comunidad de Madrid, Pfizer Inc. y la Asociación Española contra el Cáncer (AECC).
Redacción
28 febrero, 2020

27 febrero 2020

PICOR

Filed under: General — Enrique Rubio @ 15:47

PICOR

El picor, picazón o prurito es una sensación molesta o incómoda que percibimos en la piel y/o las mucosas y que nos impulsa a rascarnos. es uno de los síntomas más habituales de las enfermedades de la piel. te contamos cuáles pueden ser las causas y cómo aliviarlo.
________________________________________
Puede ir desde una leve molestia, hasta resultar insufrible y alterar significativamente la calidad de vida y el rendimiento en nuestras actividades diarias.
La sensación de picor es un problema muy común, es, de hecho, uno de los síntomas más habituales de las enfermedades de la piel y puede serlo también de algunas enfermedades sistémicas.
El picor es uno de los síntomas más habituales de las enfermedades de la piel.
En algunas de las afecciones de la piel el picor nos avisa de que se está produciendo un daño en nuestra barrera protectora de la piel. Esta situación lleva al rascado y, rascarse, produce a su vez más irritación y más picor, estableciendo un círculo vicioso que no siempre resulta fácil de romper.
El picor no es el único síntoma que se nota en la piel y suele acompañarse de otros síntomas como: enrojecimiento, manchas, ampollas, habones, piel seca, áspera o agrietada.
¿ CAUSAS DEL PICOR CUTÁNEO?
Dermatitis Atópica
Es una enfermedad crónica de la piel, más común en la infancia y que cuenta con un gran componente hereditario. sus síntomas más frecuentes son la aparición de placas eccematosas, zonas con la piel muy seca y mucho picor. las lesiones en la piel atópica tienen un riesgo mayor a la sobreinfección.
Sequedad (xerosis)
la deshidratación de la piel, debida a la edad avanzada, a que no tomes suficientes líquidos o a la falta de cuidados hidratantes, puede producir sequedad cutánea y esta sequedad causarte picor o lo más conocido como xerosis.
Picaduras de insectos
las sustancias irritantes de las picaduras y la reacción de nuestro propio organismo a ellas puede provocar picor.
otras afecciones de la piel
Patologías como la psoriasis, la dermatitis seborreica o la urticaria tienen entre sus síntomas la posible aparición de picor intenso.
reacciones a tejidos o al ambiente
ciertos tejidos, sintéticos o no, pueden producirte irritación y picor.
además, la piel es una de las barreras protectoras que tiene tu cuerpo para protegerse del exterior, incluidos los factores climáticos. el sol, el viento, el calor o el frío pueden producir quemaduras o irritaciones que generen picor.
Hongos
ciertos hongos son una causa frecuente de picor, especialmente en los pies y entre los dedos. también pueden aparecer en las manos, la espalda y las axilas.
Enfermedades Sistémicas
algunas enfermedades sistémicas, como las de origen renal o hepático pueden presentar picor entre sus síntomas.
Medicamentos
también entre los efectos secundarios y las reacciones adversas de algunos medicamentos se encuentran el picor y/o la sequedad.
Embarazo
el embarazo puede empeorar algunas patologías de la piel. además, es frecuente que durante el embarazo notes picor en algunas zonas como el abdomen por los cambios que experimenta la piel de esta zona y que puede necesitar cuidados especiales, como productos que estimulen la síntesis de colágeno.
¿cómo puedes aliviar el picor?
Hidratación adecuada, tanto internamente, tomando el agua o líquidos suficientes, como aplicando a diario lociones o cremas que aporten el agua y los lípidos que tu piel necesita.
Por supuesto seguir las indicaciones terapéuticas del médico.
Utiliza un producto de limpieza adecuado. el uso de jabones o geles demasiado agresivos puede secar o incluso irritar tu piel.
en la farmacia puedes comprar productos que hidraten y nutran la piel, algunos con activos antipruriginosos, que te ayudarán aliviar el picor:
El rascado aumenta el picor y puede provocar lesiones, sangrados y sobreinfecciones. intenta mantener las uñas cortas y limpias y controlar el rascado al máximo.
La aplicación de frío local en la zona o bañarse con agua tibia/fría puede también aliviarte.
¿ Consultar a tu médico?
Si el picor no se alivia con estas medidas. O dura más de dos semanas o
no te deja dormir o te impide llevar tu vida normal.
Cuando se extiende y te pica todo el cuerpo o
ha aparecido de manera repentina.

Xinz Hong Dong en un estudio sobre la picazón, que su bandeja de entrada se inunda de correos electrónicos. y este neurocientífico de Johns Hopkins rara vez ve tiene una respuesta adecuada a su investigación sobre el dolor. La picazón es diferente. a menudo se la pasa por alto como una molestia menor, los trastornos de picazón pueden ser devastadores. Algunas personas que escriben a Dong describen irritación enloquecedora sin una fuente obvia, pinchazos incesantes que borran el sueño durante días, pérdida de peso rápida por estar demasiado distraído para disfrutar de la comida y sentimientos de aislamiento porque nadie lo comprende del todo.
“Los correos electrónicos facilitan la consulta y no es fácil responderlas todas porque todavía no hay una solución».
Todos experimentamos picazón, pero ciertas condiciones pueden hacer que esta sensación normal se vuelva loca. las alergias y las afecciones crónicas de la piel suelen provocar picazón. pero las afecciones neurológicas, los trastornos psiquiátricos, ciertos tratamientos farmacológicos y la insuficiencia renal y hepática también pueden provocar picazón terrible y persistente, incluso sin ningún tipo de problema cutáneo. a pesar de esta amplia gama de trastornos, la picazón ha sido históricamente poco estudiada.
la administración de drogas y alimentos de los estados unidos aún no ha aprobado un solo medicamento específicamente para tratar la picazón. ahora, y dong cree que dentro de cinco años es probable que tengamos un nuevo tratamiento, a medida que los investigadores continúan revelando vías que median la picazón, las compañías farmacéuticas han comenzado a darse cuenta del fruto de esta búsqueda.
la investigación sobre el picor se asentó con el supuesto de que el picor era simplemente una forma menos severa de dolor. las cosas que desencadenan la picazón son pequeñas, por ejemplo, insectos que se arrastran por el brazo, en comparación con las fuerzas más grandes y profundas de un corte doloroso o peor. la mayoría de los investigadores afirmaron que tanto la picazón y el dolor se transmitían por las mismas vías neuronales, con la única diferencia de que la fuerza del estímulo los desencadenaba. esto es parte de un todo y proporciona una imagen incompleta.

el dolor tiene connotaciones marcadamente diferentes dél picor. por un lado, mientras que el dolor provoca reflejos y escape y evitación deliberados, por ejemplo, retirando la mano de la estufa caliente, el picor constantemente nos provoca rascarnos. es una respuesta diseñada para deshacerse de pequeños peligros, dice anne louise oaklander, profesora asociada de neurología en la facultad de medicina de harvard. más específicamente, la picazón probablemente evolucionó para ayudar a protegernos de insectos venenosos o portadores de enfermedades, espinas de plantas y otros rastreadores espeluznantes.
“Los insectos son muy pequeños y pesan solo unos pocos miligramos», por lo tanto, debe tener una fisiología sensorial capaz de detectar estímulos mecánicos o químicos extremadamente sutiles, pequeños, entregados en áreas pequeñas y pequeñas».
pensar en la picazón de esta manera ayudó a oaklander a abordar el famoso y desgarrador caso de una paciente de 39 años que sufrió un brote severo de culebrilla en la frente. causó picazón crónica tan fuera de control, que eventualmente se rascó sin intención y sin dolor su cráneo, causando un absceso subyacente y daño cerebral a largo plazo. La ley Oaklander demostró que el ataque de la culebrilla había dejado tan pocas neuronas sensoriales supervivientes sobre su ojo, que su cerebro interpretó las señales de estas células nerviosas sensoriales aisladas, dañadas y que dispararon espontáneamente como similares a un aterrizaje de insectos. los medicamentos para calmar el disparo neuronal anormal junto con vendar el área afectada para proteger contra el rascado del sueño, le permitieron finalmente dejar de picar y rascarse y dejar que el agujero en su cabeza se cierre.
los investigadores están tratando de mapear las rutas neuronales exclusivas de la picazón, a menudo inyectando sustancias productoras de picor en humanos y animales y rastreando las vías que llevan la señal de picazón desde la piel hasta el cerebro.
las histaminas fueron una de las primeras sustancias identificadas capaces de desencadenar o mediar la picazón. se encuentran tanto en nuestro sistema inmunitario como en algunas plantas, bacterias y venenos de insectos. los científicos sabían que las histaminas podían generar picazón desde principios de 1900 cuando los investigadores aplicaron gotas de las cosas a pequeños cortes en la piel humana y documentaron una respuesta a la picazón. con el desarrollo de medicamentos antihistamínicos en la década de 1940 para tratar una amplia gama de reacciones alérgicas, se convirtieron en la opción para tratar la picazón de casi cualquier tipo. a veces proporcionaron el alivio que tanto necesitaban, pero con mayor frecuencia, en un estimado de dos tercios de los casos, no funcionaron en absoluto.
estas fallas llevaron a los científicos a buscar otras opciones. durante sus estudios posdoctorales a principios de la década de 2000, dong vio una oportunidad en la cloroquina. altamente eficaz como medicamento contra la malaria, a menudo causa una picazón tan severa que los pacientes no pueden soportar continuar con la medicación. dong y sus colegas estudiaron la cloroquina en ratones, identificando una familia de receptores neuronales llamados mrgpr, receptores de la proteína g-par relacionados con mas, que respondieron al medicamento. los ratones a los que les falta el receptor se rascaron significativamente menos en respuesta a la cloroquina . el estudio de receptores MRGPR. encontró un receptor relacionado que responde a la beta-alanina, los culturistas compuestos usan para aumentar el volumen, pero los enfermos sienten múltiples picaduras de mosquitos en su cuerpo». algunos receptores MRGPR responden al contenido de ácidos biliares producidos en pacientes con picazón intensa y crónica asociada con enfermedad hepática. ahora, Dong y sus colaboradores están buscando moléculas para bloquear estos receptores con la esperanza de ayudar a los pacientes desesperados por recibir tratamiento.
pero los MRGPR no son el único objetivo prometedor. los científicos han estado buscando otros mediadores de picazón en un esfuerzo por identificar objetivos de drogas. una revisión de 2016 enumeró más de 20 medicamentos en desarrollo para diversas formas de picazón. los candidatos van desde compuestos que secuestran el ácido biliar para combatir la picazón mediada por el hígado hasta un tratamiento para la picazón inducida por el eccema que opera a través del mismo receptor responsable de la sensación de ardor que se produce al comer pimientos picantes.
El creciente interés de los investigadores y las compañías farmacéuticas significa que hay buenas razones para tener esperanza, dice el dermatólogo de Harvard Ethan Lerner, que se especializa en trastornos de picazón. «muchas compañías farmacéuticas están interesadas en esto ahora

Bibliografía
Lindzi wessel
el

Lindzi Wessel publicado 21 feb 2020 fuente brainfacts / sfn

26 febrero 2020

PRÁCTICA DE LA CIRUGÍA ESTEREOTÁCTICA

Filed under: dolor — Enrique Rubio @ 14:34

Comments (0)

25 febrero 2020

Cirugía talámica en el dolor

Filed under: dolor,General — Enrique Rubio @ 21:33

La Asociación Internacional para el Estudio del Dolor lo definió como «una experiencia sensitiva y emocional desagradable, asociada a una lesión tisular real o potencial».3 mar. 2005
Existen diferentes clasificaciones del dolor. Aquí intentamos clasificar el dolor desde un punto de vista académico según su fisiopatología subyacente (Nociceptivo y Neuropático), según su duración de presentación (agudo, crónico) y otros tipos de dolor (oncológico, psicógeno).
El aunque la actualidad la farmacología permite controlar con bastante éxito los dolores Nociceptivo no ocurre lo mismo con los Neuropático)
Las lesiones del tálamo con frío, o calor. Usando para ello el enfriador Cooper, o electro coagulación fueron muy eficaz del durante un tiempo, cuando empezó a utilizarse bomba de morfina de perfusión espinal, la lesión talámica fueron desplazadas.
Pero a lo que practicamos esta técnica nos pareció que modificando el sistema localizador y lesivo, estableció de podían ser muy válidas.
En la actualidad y para el temblor y localizando los núcleos del tálamo con resonancia magnética y ultrasonidos. Los resultados son excelentes y se está llegando a una simplicidad la aplicación de la técnica.

Personalmente cuando trabajaba en el hospital virgen del rocío de Sevilla y muy jovencito tenía la cirugía ESTEREOTÁCTICA como dedicación preferente y entonces desarrollamos la cirugía talámica para el dolor y que motivó mi afición esta técnica

Este es el fundamento de mi tesis doctoral
La analgesia que producen las lesiones intralaminaares del tálamo
Concretamente la lesión bilateral y simétrica de los núcleos del tálamo, Centro Mediano, (CM), Parafascicular (PF) y Dorso Medial (DM), produce una analgesia en los dolores intratables por procedimientos medicos y quirurgicos.

El fundamento de esta técnica.

Es conocido desde los años 1960 por los trabajos de Hassler, que la lesión de los núcleos somatosensoriales del talamo. Ventral Postero Lateral (VPL) y Ventral Postero Medial (VPM), producían dos tipos de alteraciones:

a.- Una dramática perdida de todas las sensibilidades contralaterales y la aparición en un alto porcentaje de los enfermos de disestesias contralaterales insufribles para el enfermo.

b.- Rara vez desaparecía el dolor y cuando lo hacia era por breves periodos de tiempo (109.102). Estas caracteristicas se correspondían con el conocido síndrome de Dejerine-Roussy.

La observación animal permite ver dos tipos sistemas de conducción. Uno primitivo grueso, de representación bilateral y con estancia previa e el tronco del encéfalo que constituye el Paleoespinotalamico, que conduce casi exclusivamente sensaciones dolorosas y es mas propio de las aves . Otro sistema de conducción filogenéticamente de aparición posterior , que es el Neoespinotalamico , propio de mamíferos y mas aun de primates que recoge las proyecciones contralaterales de las vías sensitivas.
Por el sistema Paleoespinotalamnico, caminan las vías sensitivas que tras hacer estancia en el tronco del encefalo y mezclarse con el sistema reticular, pasan bilateralmente hacia ambos talamos, por dentro de la lamina medular interna y son conocidos como núcleos intralaminares de tálamo y forman lo que se conoce como vías extralemniscales de las sensibilidades (43,150,174,198,).
Esto demostraba que no todos los estímulos sensitivos pasan por los núcleos somatosensoriales de ambos talamos, sino que muchos de ellos eran extralemniscales , constituyendo las fibras retículo-talamicas de disposición medial al tracto espino talamico que terminan en los núcleos intralaminares del tálamo: Paracentral, Lateral Central, Centro Mediano y Parafascicular. Este sistema de transporte sensitivo es primitivo, de sensaciones profundas, dolorosas y mal localizadas . Mientras que las sensaciones que desembocan en los núcleos VPM y VPL también de ambos talamos son mas concretas superficiales y escasamente dolorosas .
De forma que la lesión de los núcleos VPL y VPM; solo rompía el equilibrio de los relés de las sensaciones no dolorosas que no conseguían accion terapéutica ( 8174,201,224).
Nauta demostró que las vías extralenniscales del dolor eran multipless tanto en animales como en el hombre y sus proyecciones colaterales terminaban en los núcleos intralaminares del talamo (184,185).

En los años 1960 se demostró por varios autores, que las lesiones de los núcleos intralaminares se seguían de la desaparición del dolor crónico
La lesión tenia que ser bilateral y simetrica y por dentro de la lamina medular interna y en ambos talamos para que fuera efectiva y esto se había demostrado en necropsias (223,227).
El componente emocional del dolor desembocaba en el lóbulo prefrontal através de las proyecciones sensitivas que llegaban al núcleo DM, lo que permitía al Telencefalo el análisis de la sensación dolorosa Se sabia desde las celebres Leucotomias practicadas por el premio Nobel Egas Moniz en 1927, que se modificaba la personalidad del paciente que la recibia pero ademas aumentaba el umbral del dolor y era frecuente escuchar al paciente decir que el dolor ya no le importaba. Este mismo efecto se obtenia con las lesiones del Cingulo Rostral ,del nucleo DM y del nucleo anterior del talamo asi como lesiones practicas en el lobulo prefrontal (40,60,236).
De forma que las lesiones propuestas para analgesias los dolores cronicos eran, CM, PF y DM, que se extendian a los núcleos reticulares que recibian el dolor extralemniscal y el DM, que vehiculaba el dolor a los lóbulos prefrontales informándoles del componente emocional del dolor.

Material y Método.
Desde los años comprendidos entre 1969 y 1980, se operaron 50 pacientes que sufrirán dolor resistente a todos los procedimientos médicos y quirúrgicos conocidos.
La intervención se hacia colocando con anestesia local un marco estereotaxico diseñado por Leksell, que se colocaba en el craneo sujeto con tres fijadores que entraban en el cráneo hasta la tabla interna previa inyección de anestesia local
La localización de los núcleos se hacia previa ventriculografía a través de un agujero de trepano bilateral y simétrico a nivel de la sutura coronal y a 2,5 cm de la linea media. El contraste que se introducía en el sistema ventricular era una mezcla de aire y Dimer X. La cantidad total era de 8 cc. Era de capital importancia practicar la lesión en el agujero de Monro, para que al rellenar el III ventriculo pudieramos ver las comisuras grises anterior y posterior (CA y CP) con claridad..
Los núcleos a lesionar se localizan inmediatamente por fuera del III ventriculo con la siguiente localización, extraidas del Atlas de Schatelbram y Bayley.
X.- 6mm por delante de la CP
Y.- 2mm por encima del plano CA-CP
Z.- Paret lateral externa de lII ventriculo.
Las lesiones se hacian con nitrogeno liquido que circulaba por dentro de una canula metalica de 2,4 mm de diametro y diseñada por Cooper. (Cooper Criosurgery Systen)
El volumen total de la lesión es un cilindro de 6 mm. de diámetro por 12 mm de generatriz.

La lesión se empezaba enfriando progresivamente la punta de la canula hasta llegar a 200º bajo cero.

Terminada la criotalamotomia, se cerraban las heridas craneales y se trasladaba el paciente a su habitación, totalmente despierto

Resultados según la Etiología del Dolor
Numero Resultado inmediatos Resultados tardios tiempo observacion
Tumoral 39 pacientes 39 Sin dolor 100% 36 sin dolor 92,3%
2 moderado 5.1%
1 igual 2.5% Entre 1 y 6 meses
1 esta bien 30 años después
Linfoma abdominal
Desaferentizacion 11 pacientes 11 sin dolor 100%s 2 sin dolor 18,18%
6 moderado 63.6%
3 igual 27,27 % Entre 6 meses y 8 años

Complicaciones.
1 paciente con muy mal estado y metástasis múltiples fallecio 3 dias más tarde por hemorragia intraparenquimatosa
3 crisis convulsivas
1 sindrome de de Parinaud transitorio
31 paciente presentaron Sindrome frontal, indiferencia afectiva entre 2 y 7 semanas de duracion .

.
Esta tesis esta hecha en tiempos donde los métodos analgesicos eran escasos y los de utilización quirurugica en la analgesia eran mutilante proporcionando en el postoperatorio mas desaferentizacion que analgesia.

Los resultados fueron mejores en los pacientes con dolor de origen tumoral, donde un 92,3 5 murió sin dolor. Muy posiblemente la menor duración de su vida después de la intervención fue responsable de estos resultados
En los pacientes con dolor de desaferentizacion los resultados fueron pobres ya que solo un 18,18% vivieron y murieron sin dolor. Estos pacientes vivieron mas tiempo y ello condiciona la recidiva del dolor.

Las complicaciones son escasas, ya que el paciente que murió tenia muy mal estado, como la mayoría de los pacientes tumorales operados.

El síndrome frontal que presentaron muchos pacientes, era beneficioso por que el dolor era entonces un hecho que dejaba de preocuparles y les permitía vivir con cierto bienestar.
Esta técnica en manos de un conocedor de la cirugía ESTEREOTÁCTICA tenían una mortalidad muy escasa y era muy efectiva el dolor es

Conclusiones
1.- La lesion de los núcleos intralaminaares del talamo con criotalamotomia produce un alto porcentaje de analegesia. Inmediata a la cirugía.
2.- Pasadas dos semnas los buenos resultados se reducen al 70%.
3.- En los enfermo portadores de neoplasia los resultados fueron superiores. La indiferencia del sindrome frontal les permitio vivir mas bondadosamente.
4.- Los pacientes con lesiones cutaneas, mejoraban de ellas marcadamente
5.- Un alto porcentaje de pacientes dejaron de ser adictos a los fármacos marcadamente , esto fue menor en los pacientes que sufrian dolores por desaferentizacion.
6.- En pacientes con dolores por desaferentizacion y que vivieron marcadamente mas tiempo después de la intervención los resultados fueron claramente peores. Los pacientes con disestesias previas a la intervenion rara vez mejoraron de ellas (neuralgias Posherpeticas, Arrancamiento plexo braquial).
7.- Se pueden considerar escasas las complicaciones y la dudosa mortalidad de esta estadistica es tambien baja

Ya hace 40 años que se realizo esta técnica. Pero de nuevo se empiezan a utilizar con distintos sistemas de localización de los blancos y con distintos y más bondadoso sistema de lesión como es el ultrasonido.

Y posiblemente da lugar a una serie de procedimientos focalizados y facilitados por los adelantos de la tecnología

Bibliografía

Lesiones en el tálamo para el dolor Enrique Rubio García

24 febrero 2020

EL CEREBRO DE UN PSICÓPATA

Filed under: Emocion y Sentimientos — Enrique Rubio @ 12:29

COMO ES EL CEREBRO DE UN PSICÓPATA
Una revisión científica sugiere que el estrés emocional en la infancia precipita la sobremaduración de algunas regiones cerebrales y dificulta la gestión de las emociones
La alteración de la estructura para explicar la alteración de la función es la constante en neurobiología El cerebro de un psicópata es diferente, son seres que tienen total falta de empatía, saben lo que esta bien y lo que está mal pero no les afecta el dolor ni los sentimientos de otras personas.
Múltiples estudios se han hecho sobre este tema de los que mencionaré algunos
La Universidad de Wisconsin-Madison ha descubierto que el cerebro de los psicópatas es diferente del resto

El cerebro de los psicópatas presenta indicios de una hipermaduración acelerada durante la infancia, hecho que los protege del sufrimiento, pero dificulta que gestionen sus emociones, aunque son plenamente conscientes de sus actos, según un estudio publicado en Psychological Medicine.
“El psicópata puede ser el resultado de un estrés emocional en las primeras fases de la vida, que provoca la hipermaduración de las estructuras del cerebro implicadas en los sentimientos y la toma de decisiones”, explica el doctor Jesús Pujol.
El especialista es director de investigación de la Unidad de Resonancia Magnética del Servicio de Radiología del Hospital del Mar y del Instituto Hospital del Mar de Investigaciones Médicas (IMIM) y CIBERSAM.
Investigadores del Hospital del Mar de Barcelona y del Parc Taulí de Sabadell también descubrieron que el cerebro de los psicópatas es parecido al de personas que consumen esteroides durante un largo periodo de tiempo.

Los científicos analizaron el cerebro de personas con psicopatías mediante imágenes obtenidas con resonancia magnética para comprobar que sufren una hipermaduración o maduración acelerada de determinadas zonas del cerebro, hecho que afecta a su capacidad para gestionar las emociones.
La investigación ha analizado más de 400 artículos publicados en revistas científicas, ha comprobado que el factor emocional temprano tiene una gran influencia en el desarrollo, formación y comportamiento del psicópata.
El psicópata puede ser el resultado de un estrés emocional en las primeras fases de la vida, que provoca la hipermaduración de las estructuras del cerebro implicadas en los sentimientos y la toma de decisiones.
Los investigadores lo explican por la aparente reducción de la sustancia gris detectada en las imágenes por resonancia magnética, que es debida a un proceso de mielinización excesiva o incremento de sustancia blanca, compatible con esta maduración acelerada.
Las zonas más afectadas son el sistema frontal-basal y temporal anterior y el frontal medial y cíngulo posterior, que relacionan los estímulos externos con las reacciones y los sentimientos.
Esta alteración tiene efectos secundarios en forma de falta de escrúpulos y de remordimientos, no tienen freno emocional”, según Pujol.
Esta diferencia respecto a un cerebro normal, según el investigador, “no afecta a su capacidad de razonamiento, tienen sentimientos, a pesar de parecer fríos emocionalmente”.

Jiménez Martínez, C. 2017. No es mi culpa, fue mi cerebro. ¿Es esta una afirmación válida para aplicar la inimputabilidad a individuos con trastornos de la personalidad y psicópatas?. Derecho Penal y Criminología. 37, 103 (jul. 2017), 81-107. DOI:https://doi.org/10.18601/01210483.v37n103.05.

«Los psicópatas son personas con problemas de relación interpersonal y de gestión de las emociones. Aparentemente son fríos, aunque tienen emociones muy intensa pero no tienen remordimientos, que es lo que da una tendencia hacia la delincuencia, en algunos casos»,
Una revisión científica de otros estudios publicados y ha constatado que el cerebro de los psicópatas es distinto. La investigación apunta a que el estrés emocional en la infancia precipita la sobremaduración de algunas regiones cerebrales como un sistema de protección contra el sufrimiento, pero termina dificultando también la gestión de las
La complejidad de la psicopatía va más allá de los estereotipos. Lo que sí parece cierto es que tienen diferencias cerebrales estructurales
. Pujol y su equipo revisaron más de 400 artículos científicos en los que se había analizado el cerebro de las personas con psicopatía a través de resonancias magnéticas. El metaanálisis, publicado en la revista científica Psychological Medicine, ha concluido que el cerebro de los psicópatas presenta una maduración acelerada de varias regiones cerebrales relacionadas con el procesamiento emocional y el cognitivo. «El cerebro de los psicópatas es diferente desde el punto de vista anatómico y funcional. Hay diferencias en las áreas que procesan la cognición y el razonamiento y en las que procesan la actividad emocional. La conexión entre estas dos áreas falla», explica Pujol.
Los investigadores encontraron que, desde el punto de vista anatómico, en las regiones de lóbulo temporal (donde está la amígdala, relacionada con la emociones) y en el frontal (encargado de las funciones cognitivas) había «una aparente atrofia de la sustancia gris». «Sin embargo, lo que luego nosotros postulamos es que, en realidad, lo que había era un aumento de la sustancia blanca, lo que implica una sobremaduración de esas áreas»,.
En la práctica, esta alteración cerebral provoca que, ante un dilema moral, la activación de los dos sistemas (el cognitivo y el emocional) se bloquee. Ni su capacidad de razonamiento ni sus sentimientos o emociones están anulados. Lo que ocurre es que «la asociación entre emoción y cognición en la toma de decisiones está bloqueada», aclara el médico. Con todo, señala, «son responsables de sus actos».
Los investigadores han encontrado también similitudes entre los cerebros de los psicópatas y las personas que consumen durante más de 10 años esteroides androgénicos
Esta similitud no implica que los consumidores de esteroides acaben desarrollando, a largo plazo, un trastorno psicopático. «Hay una semejanza anatómica de las dos patologías. Si bien es cierto que el control de los impulsos y la conducta pueden cambiar tras consumir esteroides durante largos períodos de tiempo,

23 febrero 2020

El cerebro de los delincuentes depende del tiempo de enfermedad

Filed under: depresion demencias — Enrique Rubio @ 21:16

Los delincuentes tienen un cerebro diferente según el tiempo de actuación

Múltiples investigadores se han agrupado integrado buscando un prototipo en el cerebro de los delincuentes, y hasta ahora no se han encontrado datos objetivos que puedan hacer un diagnóstico estructural y de localización este trabajo ofrece la posibilidad de que la actuación transitoria de estos enfermos puede redimirlos

Un estudio ha encontrado variaciones fisiológicas en comparación con aquellos que no transgredieron la ley o que solo lo hicieron durante la adolescencia
La mayoría de adolescentes que cometen delitos dejan de hacerlo en la edad adulta (South_agency / Getty Images/iStockphoto)
Los padres no deberían preocuparse mucho si sus hijos quebrantan la ley de adolescentes, siempre que se hayan comportado bien en su primera infancia. Así lo afirma un estudio publicado en la revista The Lancet Psychiatry . En él se sugiere que aquellos que continúan delinquiendo a lo largo de su vida ya mostraban un comportamiento antisocial desde una edad temprana y presentan una estructura cerebral marcadamente diferente de los que no lo hacen.
La adolescencia es una fase del desarrollo a veces un poco tormentosa en la que los jóvenes buscan la independencia de los adultos y algunos pueden llegar a cometer delitos para reafirmar esta independencia. Trabajos anteriores han demostrado que el crimen aumenta en esta etapa pero la mayoría de los perpetradores se convierten en adultos respetuosos de la ley y solo una minoría, menos del 10% de la población general, continúa delinquiendo durante toda su vida.

Los delincuentes presentan una estructura cerebral diferente (Charité – Universitätsmedizin Berlin)
Con anterioridad ya había sido señalado el desarrollo anormal del cerebro como un aspecto fundamental del comportamiento antisocial persistente durante el curso de la vida. Esta investigación, según afirman los autores en el artículo, da un paso más y permite definir diferentes trayectorias de este tipo de comportamiento desde la infancia.
“Los hallazgos reiteran investigaciones previas que realmente resaltan que existen diferentes tipos de delincuentes juveniles. No todos deberían ser tratados de la misma manera ”, declaró a The Guardian la coautora del estudio Essi Viding, profesora de Psicopatología del Desarrollo en el University College de Londres (Inglaterra).
Para llevar a cabo la investigación, el equipo empleó datos de 672 personas nacidas en Nueva Zelanda entre abril de 1972 y marzo de 1973. Se recopilaron registros detallados del comportamiento antisocial de los participantes a intervalos regulares desde los siete años hasta los 26 años. A los 45 años se les escaneó el cerebro mediante resonancia magnética funcional.

El equipo dividió a los participantes en tres grupos según su historial de comportamiento antisocial: 441 mostraron pocos signos de tal comportamiento, 151 solo fueron antisociales en la adolescencia y 80 ya mostraron un comportamiento antisocial en la infancia.
Los escáneres cerebrales de adultos con un largo historial de transgresiones mostraban una superficie más pequeña en muchas áreas del cerebro en comparación con aquellos con un historial limpio.
Su materia gris era más delgada en regiones vinculadas a la regulación de las emociones, la motivación y el control del comportamiento, aspectos de la conducta con los que habían tenido problemas. Aquellos que habían sido delincuentes solo en la adolescencia también mostraron algunas diferencias en esta medida en comparación con los que respetaron la ley.
Para los autores los delincuentes de largo recorrido operan bajo alguna desventaja a nivel del cerebro (LightFieldStudios / Getty Images/iStockphoto)
La profesora de Psicología en la Universidad de Duke (EE.UU.)Terrie Moffitt, también autora de la investigación, afirmaba en el mismo periódico que el estudio ha ayudado a arrojar luz sobre lo que podría estar detrás de un comportamiento antisocial persistente.
“Pudo haber sido simplemente que el grupo que mantuvo esta conducta eligió llevar sus vidas de una manera más difícil y podría haber elegido de manera diferente. Yo creo que lo que vemos con estos datos es que en realidad están operando bajo alguna desventaja a nivel del cerebro”, dijo la profesora.
El equipo señala en base a los resultados que se necesita hacer más para identificar a los niños con signos de comportamiento antisocial y así ofrecerles apoyo tanto a ellos como a sus padres, una medida que para los autores podría reducir el crimen en un futuro.
Sin embargo, qué es la causa y qué el efecto en los delincuentes persistentes no está del todo claro. Según los investigadores, los factores genéticos y ambientales, como una infancia con carencias, pueden haber moldeado sus cerebros en etapas tempranas de la vida.
También es posible que otros factores posteriores, como el tabaquismo, el abuso de alcohol o drogas, hayan causado los cambios cerebrales. De hecho, de todos los grupos, el que seguía delinquiendo en la edad adulta era el que presentaba mayores tasas de consumo de sustancias adictivas

REDACCIÓN
18/02/2020 18:12 | Actualizado a 18/02/2020 19:22

Los telómeros María Blasco

Filed under: GENES — Enrique Rubio @ 14:17

LOS TELÓMEROS
“ La bióloga María Blasco , directora del Centro Nacional de Investigaciones Oncológicas (CNIO), que ha dedicado toda su carrera a estudiar los telómeros y a aclarar qué relación tienen con el cáncer y la longevidad. En una de sus últimas investigaciones, publicada en la revista PNAS , ha averiguado cómo los telómeros regulan la longevidad de las especies.
Creo que los investigadores en general se lo pasan muy bien buscando. Cuando leo los estudios de los investigadores y sobre todo investigadoras y el placer que le produce no solo el hallazgo, sino sobre todo la búsqueda, siento verdadera envidia y me siento todo lo feliz que yo puedo ser, porque he llegado a mayor y sigo enamorado de las ciencias sobre todo del sistema nervioso y sobre todo de la biología de éste y de la conexión entre lo orgánico y lo psíquico. Todo esto me parece tan hermoso, que tengo tendencia a rechazar las novelas y el culto que alrededor de ellas se ha establecido. Quiero preocuparme por verdades útiles, y caiga quien caiga. La publicidad dice que en España se publican cada año aproximadamente 84 mil libros. Y le pido a los escritores y publicadores, que no me señalen como inculto si no me los leo todos o casi todos.
Me interesan aquellos libros que me aportan conocimientos útiles, y si me olvidó de alguna historia de amor, pues vale me lo perdí, Dios proveerá.
Pero lo que no quiero perderme es como María Blasco me cuenta para que sirven los telómeros en los cromosomas, por ejemplo.
¿Qué son los telómeros?
El ADN se organiza en cromosomas en el núcleo de nuestras células. Los telómeros son estructuras que se encuentran en los extremos de los cromosomas y que protegen el material genético. Son importantísimos para la vida porque, sin telómeros, las células no podrían vivir. Pero se acortan a medida que las células se multiplican y envejecemos. Cuanto más cortos son los telómeros, más enfermedades se producen y mayor es el riesgo de muerte.
El estudio de los telómeros mostraba algo desconcertante. Las personas, que tienen larga vida comparándola con otros animales, tienen los telómeros relativamente cortos.
Los ratones, que viven mucho menos tiempo, tienen los telómeros mucho más largos. Y también los telómeros de los ratones se acortan más rápido que los nuestros. Esto llevó a pensar que tal vez lo importante no era la longitud de los telómeros sino la velocidad de acortamiento.
Las personas, que tenemos vidas largas en comparación con otros animales, tenemos los telómeros cortos”
La Dr.ª María Blasco se enfrentó con el problema con toda la energía que ella tiene y con la pasión que pone en sus estudios.
Al principio sólo teníamos las observaciones de humanos y ratones. Para comprobar si era una regla general, necesitábamos datos de más animales. Nos pusimos en contacto con el zoo de Madrid y con Carola Sanpera, una bióloga de la Universidad de Barcelona que trabaja con gaviotas salvajes en el delta del Ebro. Así obtuvimos muestras de delfines, renos, elefantes, flamencos, buitres… En total, nueve especies de aves y mamíferos.
Nos hubiera gustado incluir reptiles, anfibios y peces… Llegamos a medir los telómeros de dos tortugas, pero necesitábamos más individuos para tener datos fiables de la velocidad de acortamiento de los telómeros según la edad, por lo que no las incluimos en el análisis.
También sería muy interesante estudiar los telómeros en árboles, hay especies que viven varios siglos. Pero en este estudio analizamos la longitud de los telómeros en células de la sangre. Los árboles no tienen sangre, así que los resultados no hubieran sido comparables.
La velocidad a la que se acortan los telómeros es más importante que su longitud inicial”
Al comparar los telómeros de estas nueve especies?
El primer resultado es que no hay ninguna relación entre la longitud de los telómeros al nacer y la longevidad de una especie. Lo que habíamos visto en ratones y humanos se confirmó en las otras especies. Entre las que analizamos, los delfines mulares son los que nacen con telómeros más largos. Después vienen, por este orden, ratones, elefantes de Sumatra, gaviotas de Audouin… Y los más cortos son los de las cabras y las personas.
La velocidad de acortamiento de los telómeros, se ajusta perfectamente a una ley potencial, que es una relación matemática que nos indica la longevidad de una especie a partir de la velocidad a la que se acortan los telómeros. Es válida tanto para las aves como para los mamíferos que hemos estudiado. Hemos visto, por ejemplo, que flamencos y elefantes tienen la misma longevidad y la misma velocidad de acortamiento de los telómeros, pese a que son especies evolutivamente muy distantes y de tamaños muy diferentes.
Las especies grandes como elefantes y ballenas suelen vivir más que las pequeñas como conejos y ratones. Pero nuestros resultados indican que el acortamiento de los telómeros es más relevante que el tamaño.
El estrés crónico, que aumenta el riesgo de numerosas enfermedades, acelera el acortamiento de los telómeros”
¿El acortamiento de los telómeros es causa sin duda del envejecimiento?
En experimentos con ratones en que se les han acortado los telómeros, se les ha acelerado el envejecimiento. Y, al revés, cuando hacemos que los ratones tengan telómeros largos durante más tiempo, también hacemos que vivan más.
¿Puede ser el mecanismo que ha encontrando la evolución para regular la longevidad de las especies?
Creemos que hemos identificado un mecanismo biológico fundamental y de momento común a todas las especies que hemos estudiado. Pero tendríamos que estudiar una muestra más amplia de especies para hacer una afirmación categórica. Y nos gustaría estudiar cómo las condiciones ambientales en que vive un animal afectan al acortamiento de los telómeros y a la longevidad, como ya se ha visto que ocurre en personas.
Sería muy interesante estudiar los telómeros en árboles, hay especies que viven varios siglos”
¿En personas?
Elizabeth Blackburn [que ganó el premio Nobel por sus investigaciones sobre los telómeros] demostró que el estrés crónico, que aumenta el riesgo de numerosas enfermedades, acelera el acortamiento de los telómeros.
¿Se podría predecir la esperanza de vida de una persona a partir de los telómeros?
Podrían ser un biomarcador de envejecimiento. Está en estudio si tienen valor pronóstico para algunas enfermedades de manera similar a cómo ahora utilizamos el colesterol como indicador de riesgo cardiovascular. En un futuro podría tener sentido medir la longitud de los telómeros de una persona a distintas edades para calcular la velocidad de acortamiento y para estudiar el impacto de los estilos de vida sobre los telómeros.
Lo millones de elemento que tiene el sistema nervioso humano nos llevan continuamente a una nueva búsqueda.
Un investigador tiene que tener mucho cuidado con el pensamiento romántico. Que yo lo defino como “ si esto ha sido así, pues lo próximo tiene que ser de esta otra manera”. Esta situación es siempre errónea , no hay nunca un tras esto viene esto otro.
Detrás del último no va nadie, ¿pero por cuánto tiempo?
Mi enhorabuena a María Blasco que se emborracha con el conocimiento.

Telómero básico

Filed under: GENES — Enrique Rubio @ 14:12

Telómero básico

Un cromosoma (izquierda) y un telómero (a la derecha).
Los telómeros (del griego τέλος [telos], «final», y μέρος [meros], «parte») son los extremos de los cromosomas. Son regiones de ADN no codificante, altamente repetitivas, cuya función principal es la estabilidad estructural de los cromosomas en las células eucariotas, la división celular y el tiempo de vida de las estirpes celulares. Además están involucradas en enfermedades tan importantes como el cáncer.
Los organismos procariotas tienen cromosomas circulares que no poseen telómeros. Algunos procariotas poseen cromosomas lineales con secuencias teloméricas, cuya secuencia es diferente a la de eucariotas.

Los telómeros fueron descubiertos por Hermann Joseph Muller durante la década de los años 30 del siglo XX, que junto a Barbara McClintock recibieron el Premio Nobel. Desde entonces, se ha avanzado mucho en el conocimiento de los telómeros, gracias a las técnicas de genética molecular. Proponían que los telómeros, situados en los extremos de los cromosomas, tenían la función de prevenir que éstos se fusionaran al ponerse en contacto por sus extremos, lo que produciría consecuencias desastrosas para las células.
Los científicos Elizabeth H. Blackburn, Carol W. Greider y Jack W. Szostak son reconocidos con el Premio Nobel de medicina en 2009 por la descripción molecular de los telómeros, la demostración de su conservación evolutiva y el descubrimiento de la telomerasa, enzima central de la maquinaria celular para la síntesis del telómero, por haber logrado un muy consistente modelo que explica el ‘problema de la terminación de la replicación’ (end-replication problem) y el mecanismo molecular de protección de los extremos cromosomales.
En los cromosomas existen dos tipos de ADN: el ADN codificante, que constituye los genes, es decir, porciones del cromosoma donde se encuentra la información que codifica las proteínas, el Ácido ribonucleico de transferencia y los ácidos ribonucleicos ribosomales, disperso entre una gran cantidad de ADN no codificante. Entre el ADN no codificante se encuentran el que forma el centrómero y los telómeros de los cromosomas. El centrómero es una porción alargada de ADN que permite que la molécula del ADN se fije al huso mitótico durante la fase M del ciclo celular. Por su parte, los telómeros juegan un importante papel en la vida de las células ya que mantienen la integridad de las terminaciones de los cromosomas impidiendo que se enmarañen y adhieran unos con otros, ayudan a que los cromosomas homólogos se emparejen y entrecrucen durante la profase de la meiosis. Los telómeros humanos y murinos[cita requerida] contienen hasta 2.000 veces repetida la secuencia 5′ TTAGGG 3′:
5’…TTAGGG TTAGGG TTAGGG TTAGGG TTAGGG TTAGGG..3′
3’…AATCCC AATCCC AATCCC AATCCC AATCCC AATCCC..5′
Algunas teorías del envejecimiento y de la carcinogénesis se basan en que los telómeros son como los relojes o temporizadores de la célula, ya que marcan el número de divisiones celulares, hasta que la célula muere. Los fundamentos de estas teorías son:
El ADN contenido en los telómeros no se replica completamente durante la duplicación del ADN, ya que los enzimas ADN polimerasa solo pueden trabajar en dirección 5′->3′. Para una de las dos hebras (conductora) esto no supone problema, pero para poder duplicar simultáneamente la hebra retrasada (que se presenta en dirección 3′->5′) deben formarse los fragmentos de Okazaki. El inicio de cada segmento está constituido por un primer de ARN. Estos son finalmente sustituidos por ADN, sin embargo, el primer del extremo 5′ de la hebra no puede ser completado, ya que se requeriría trabajar en dirección 3′->5′. Como consecuencia, el telómero que se va haciendo cada vez más y más corto en cada replicación.
Los telómeros, en la mayoría de las especies animales y vegetales y en los microorganismos, están constituidos por subunidades cortas de nucleótidos generalmente ricos en timina (T) y guanina (G). En los humanos la secuencia de cada una de estas subunidades es TTAGGG.
El número de repeticiones es variable según las distintas células de un mismo individuo; sin embargo el promedio de repeticiones suele ser constante para cada especie. En una persona se calcula que alcanza aproximadamente las 2.000 repeticiones. Según Consulosky Slater.[cita requerida]
La telomerasa es una enzima formada por un complejo proteína-ácido ribonucleico con actividad transcripatasa inversa (es decir, puede sintetizar ADN a partir de una secuencia de ARN que ella misma porta), que es producida en células germinales embrionarias que permite el alargamiento de los telómeros.
La telomerasa es reprimida en las células somáticas maduras después del nacimiento, lo que producen un acortamiento del telómero después de cada división celular.
Cuando la longitud del telómero alcanza cierto límite, se interrumpen las mitosis quedando las células en el estadio G0 (G Cero) de su ciclo celular.
El desgaste del telómero en el transcurso de ciclos celulares, impide su función protectora del cromosoma, con lo que éste se vuelve inestable, se fusiona o se pierde. Las células que presentan estos defectos, no sólo son incapaces de duplicarse, sino que dejan de ser viables y se activan los procesos de apoptosis o muerte celular programada.
Muchas células cancerosas reactivan la actividad de telomerasa, favoreciendo la proliferación de un clon maligno. Se están estudiando fármacos que inhiben la telomerasa y así detener el crecimiento de las células malignas, por lo que podría ser una nueva diana terapéutica del cáncer[cita requerida].
Especialistas del Centro Nacional de Investigaciones Oncológicas (CNIO), han desarrollado un tratamiento que actúa sobre los genes que, aplicado en animales adultos, una única vez, consigue de manera segura alargar la vida media de los individuos. Este tipo de investigaciones obligaba a modificar permanentemente los genes de los animales desde la fase embrionaria. Sin embargo, la terapia génica desarrollada por el CNIO para combatir el envejecimiento ha sido probada en ratones adultos de uno y dos años, y tuvo un efecto «rejuvenecedor» sobre ellos.
El procedimiento consiste en tratar modificar la carga genética de un virus cuyo ADN ha sido modificado; sus genes se sustituyen por uno de los genes más importantes para el envejecimiento de las especies tratadas: el que codifica la enzima telomerasa. La telomerasa frena este efecto, reconstruye los telómeros y corrige el reloj biológico de la célula. El virus con el ADN tratado e inoculado en el animal actúa como un vehículo que deposita el gen de la telomerasa en las células.1
La ADN polimerasa sólo puede fabricar nuevas hebras de ADN cuando se mueve a lo largo de la cadena molde, polimerizando nucléotidos en la dirección 5′ → 3′ (sobre una hebra molde de polaridad 3′ → 5′). Esto no plantea ningún problema para la hebra denominada «contínua» de un cromosoma, dado que la polimerasa se puede mover libre e ininterrumpidamente desde del origen de replicación hasta el final del cromosoma o hasta que encuentra una señal de terminación. No ocurre lo mismo cuando la hebra molde es la de direccionalidad 5´ → 3′ cuya replicación debe ser forzosamente discontinua, dado que el complejo de replicación se mueve coordinadamente sobre las dos hebras parentales, de direccionalidades opuestas. Cuando la horquilla de replicación se ha abierto lo suficiente, la ADN-polimerasa sintetiza un fragmento del ADN complementario en el sentido contrario al del avance del complejo de replicación. Luego de formarse este fragmento, la síntesis de un nuevo cebador da comienzo a la polimerización de un nuevo fragmento, y así sucesivamente. Más tarde, estos fragmentos de ADN (llamados fragmentos de Okazaki) serán empalmados mediante una ligasa.
Sin embargo, al llegar al final del cromosoma, el último fragmento de Okazaki queda a una distancia del extremo de su hebra molde que resulta insuficiente para el agregado de un nuevo cebador. Por esta razón, la cadena discontinua no se puede completar y se produce un acortamiento asimétrico (es decir, sólo en la hebra hija) del telómero. Durante cada replicación, el proceso se repite, acortando progresivamente los telómeros en ambos extremos del cromosoma. Se estima que las células humanas pierden unos 100 pares de bases de ADN telomérico en cada replicación. Esto representa unos 16 fragmentos TTAGGG. Teniendo en cuenta el número inicial de estas secuencias, al cabo de unas 125 divisiones mitóticas, el telómero se ha perdido completamente
La pregunta es: ¿es debido a esto que en las células somáticas, después de un número determinado de divisiones, la célula muere?
Los experimentos de Hayflick mostraron que las células normales (no cancerosas) no crecen in vitro de forma indefinida pese a suministrarle todos los nutrientes y factores de crecimiento necesarios. Las células obtenidas de recién nacidos cultivadas in vitro experimentan unas 100 divisiones, mientras que células obtenidas de sujetos mayores, solo se dividen unas 20 a 24 veces.2 ¿Es esto debido a los telómeros que representan como un reloj que determina la longevidad de las células?
A favor de esta hipótesis está el hecho de que algunas células son inmortales, como las células germinales, las células eucariotas unicelulares (como el Paramecium) o algunas células tumorales. En todas ellas existe una enzima, denominada telomerasa que después de cada división reinstaura la integridad de los telómeros.
La telomerasa (TERT)
Es una transcriptasa inversa que sintetiza ADN a partir de un molde de ARN. Se trata de una ribonucleoproteína que contiene en su molécula la secuencia AAUCCC capaz de crear e insertar los fragmentos TTAGGG que se pierden en cada división. En 1998, Bodnar y col introdujeron en dos tipos de células humanas normales, telomerasa-negativas, el gen que codifica la telomerasa. En contraste con las células normales que mostraban senescencia y un acortamiento de los telómeros, los clones expresando la TERT mostraron telómeros elongados, se dividían vigorosamente y mostraron una reducción de la beta-galactosidasa, un biomarcador de la senescencia. Las células transformadas para expresar la TERT mostraron un cariotipo normal y su longevidad ha superado la normal en más de 20 divisiones.
Muchas células cancerosas derivan de células somáticas, y se ha comprobado la presencia de telomerasa en el 75-80% de las líneas tumorales. Esto no quiere decir que la telomerasa induzca el cáncer. Es más, Kathleen Collins de la Universidad de Califormia en Berkeley,[cita requerida] encontró que pacientes con una enfermedad congénita muy poco frecuente, la disqueratosis congénita, tenían niveles de telomerasa anormalmente bajos, muriendo no obstante en muchos casos de cáncer gastrointestinal. A pesar de esta incongruencia, se sabe que la agresividad de las células tumorales está relacionada con sus niveles de telomerasa y que niveles altos de esta enzima son indicativos de la malignidad del tumor. Recientemente la FDA ha autorizado dos estudios clínicos con telomerasa, uno de ellos encaminado a obtener un mejor diagnóstico del cáncer cervical y el otro para evaluar un fármaco contra la leucemia mieloide.[cita requerida]
En Japón, se está siendo utilizado en niños con neuroblastoma 4S. Al parecer estos niños tienen un cáncer metastásico, pero los tumores son telomerasa negativos y aproximadamente el 80% llegan a una remisión espontánea una vez que el tumor ha sido eliminado quirúrgicamente. El estudio identifica los que son telomerasa-positivos, de manera que puedan ser tratados de una manera más agresiva.
Algunas secuencias conocidas de telómeros[editar]
Algunas secuencias conocidas de telómeros
Grupo Organismo Secuencia del telómero (Dirección 5’a 3′ hasta el fin)
Protozoos ciliados
Tetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Protozoos apicomplejos
Plasmodium
TTAGGG(T/C)
Plantas superiores
Arabidopsis thaliana
TTTAGGG
Algas verdes
Chlamydomonas
TTTTAGGG
Protozoos cinetoplástidos
Trypanosoma, Crithidia
TTAGGG
Mohos del fango
Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Hongos filamentosos
Neurospora crassa
TTAGGG
Vertebrados
Humanos, ratón, Xenopus
TTAGGG
Ascáridos
Ascaris lumbricoides
TTAGGC
Insectos
Bombyx mori
TTAGG
Levaduras aisladas
Schizosaccharomyces pombe
TTAC(A)(C)G(1-8)
Levaduras agregadas Saccharomyces cerevisiae
Candida glabrata
Candida albicans
Candida tropicalis
Candida maltosa
Candida guillermondii
Candida pseudotropicalis
Kluyveromyces lactis
TGTGGGTGTGGTG (de copias de ARN)
or G(2-3)(TG)(1-6)T (consenso)
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTA[C/A]GGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT
Referencias
Blackburn, E. H. 1991. Structure and entonces tener to take entonces tener to take function of telomeres. Nature 350:569-72.
Witzany, G. 2008. The Viral Origins of Telomeres and Telomerases and their Important Role in Eukaryogenesis and Genome Maintenance. Biosemiotics 1: 191-206.
Toftgård, Rune. 2009. Maintenance of chromosomes by telomeres and the enzyme telomerase.The Nobel Assembly at Karolinska Institutet – The Nobel Prize in Physiology or Medicine [1]

22 febrero 2020

Lactoferrina

Filed under: INFECCIONES E INFLAMACION — Enrique Rubio @ 21:45

La lactoferrina acentúa las defensas para prevenir el coronavirus
El fundador de Sesderma anima a usar Lactyferrin Defense como una solución para reforzar el sistema inmunitario

Con la llegada del del coronavirus Covid 19 el miedo se apodera del mundo, y no tenemos otra escapada, que aislar al virus y aislarnos nosotros. Con respecto a la epidemia de gripe de 1918, la Gripe Española, lo único que superamos en nuestro tiempo a 1918, es la capacidad de organización y la comunicación. Que no es poco. Y esto está evitando por ahora una catástrofe.
Por eso cuando alguien nos ofrece un remedio aunque sea sutil nos alegra el ilusiona
La lactoferrina actúa en el organismo como una sustancia natural que forma parte de nuestro sistema inmunológico. “Lactyferrin Defense tiene multitud de propiedades, aunque la más destacable en el momento actual es que funciona como un potente antiviral”. Así lo afirma Gabriel Serrano, dermatólogo y fundador de los Laboratorios Sesderma, en una reciente charla que dio en la que apuntó a la lactoferrina liposomada como una solución pionera para la prevención y tratamiento del Covid-19, diversos virus y otras propiedades de la nanolactoferrina en patologías no infecciosas.
El coronavirus sigue amenazando a China y el número de personas afectadas sigue en aumento. Ante esta situación, Serrano, cuya empresa ha donado más de cien mil mascarillas en el país asiático, explicó las ventajas de la lactoferrina para prevenir el virus. “Sesderma tiene una solución muy efectiva contra el coronavirus, de hecho, ya estamos en contacto con las autoridades chinas de Wuhan y Lactyferrin ya está llegando a las zonas más afectadas. La perspectiva de cara al coronavirus es crear una vacuna, pero esto puede llevar al menos un año. Sin embargo, Lactyferrin va a contribuir notablemente a reducir los contagios y ayudar a los pacientes afectados”.
Como en la gripe y otras infecciones respiratorias, las medidas de carácter general y de aplicación individual, como el lavado de manos y la higiene respiratoria y ambiental, son las medidas más efectivas a poner en marcha. Sin embargo, el dermatólogo entiende que estas recomendaciones no son suficientes: “El protocolo de prevención que hemos creado con Lactyferrin Defense se administra por vía oral, que es el más idóneo, pero recientemente hemos encontrado una vía mucho más rápida y eficaz, a través del nuevo dispositivo Nanomist que vaporiza la piel con lactoferrina liposomada en burbujas lipídicas”. La aplicación de nanotecnología en el desarrollo de Lactyferrin Defense es lo marca la diferencia frente al resto de productos con lactoferrina ya existentes en el mercado.
La lactoferrina está presente en el calostro, en las lágrimas e incluso en la saliva, proporcionando una protección global. La proteína, de acción antivírica, antiinflamatoria y antioxidante, tiene un gran poder de estimulación del sistema inmune que activa los mecanismos naturales de defensa.
Más de un centenar de personas, como Margaret Chen, presidenta de China Club Spain, el presidente del Colegio Oficial de Farmacéuticos de Madrid, Luis J. González Díez y la vocal de Dermofarmacia y Productos Sanitarios, Rosalía Gozalo, asistieron a la conferencia que Serrano impartió en Madrid.

Older Posts »

Powered by WordPress